(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
(19) World Intellectual Property Organization
International Bureau
lllllllllillllllllllllllillllllllllllllllllllllllli
(43) International Publication Date (10) International Publication Number
30 October 2003 (30.10.2003) pCT WO 03/089569 A2
(51) International Patent Classification': C12N
(21) International Application Number: PCTAJS02/31599
(22) International Filing Date; 24 October 2002 (24.10.2002)
(25) Filing Language: English
(25) Publication Language: English
(71) Applicant (for all designated States except US): ELI
LILLY AND COMPANY [US/US]; Lilly Corporate
Center, Indianapolis, IN 46285 (US).
■ (72) Inventor; and
; (75) Inventor/Applicant (^b;- DS'on/)';: ROmiNSON, Scott,
j William [AU/US]; 7918 Cove Trace Court, Indianapolis,
I IN 46256 (US).
I (74) Agents: WISKERCHEN, MaryAnn et al.; Eli Lilly and
! Company, P.O. Box 5288, Indianapolis, IN 46206-6288
I (US).
= (81) Designated States (naiional): AE, AG, AL, AM, AT (util-
: ity model), AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA,
i CH, CN, CO, CR, CU, CZ (utility model), CZ, DE (util-
: ity model), DE, DK (utility model), DK, DM, DZ, EC, EE
i (utility model), EE, ES, FI (utility model), FI, GB, GD, GE,
! GH, GM, HR, HU, ID, IL, IN, IS, JP, KB, KG, KP, KR, KZ,
i LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN,
: MW, MX, MZ, NO, NZ, CM, PH, PL, PT, RO, RU, SD,
SE, SG, SI, SK (utility model), SK, SL, TJ, TM, TN, TR,
TT, TZ, UA, UQ, US, UZ, VC, VN, YU, ZA, ZM, ZW.
(84) Designated States (regional): ARIPO patent (GH, GM,
KB, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZM, ZW),
Eurasian patent (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM),
European patent (AT, BB, BG, CH, CY, CZ, DE, DK, EE,
ES, H, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE, SK,
TR), OAPI patent (BF, BJ, CF, CG, CI, CM, GA, ON, GQ,
GW, ML, MR, NE, SN, TD, TG).
Declarations under Rule 4.17:
— as to applicant 's entitlement to apply for and be granted
a patent (Rule 4.17 (ii)) for the following designations AE,
AG, AL, AM, AT, AU, AZ, BA. BB, BG, BR, BY, BZ, CA, CH,
CN, CO, CR, CU, CZ, DE, DK, DM, DZ, EC, EE, ES, FI,
GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG,
KP. KR. KZ, LC. LK. LR, LS LT. LU. LV, MA. MD. MG. MK
MN, MW, MX, MZ, NO, NZ, OM, PH, PL. PT, RO, RU. SD,
SE. SG, SI, SK SL. TJ. TM. TN. TR. TT, TZ. UA. UG. UZ.
VC, VN, YU, ZA, ZM, ZW, ARIPO patent (GH, GM, KE, LS,
MW. MZ. SD, SL. SZ TZ. UG, ZM, ZW), Eurasian patent
(AM, AZ. BY, KG, KZ, MD, RU, TJ. TM), European patent
(AT, BE. BG, CH, CY. CZ. DE, DK, EE. ES. FI, FR GB,
GR, IE, IT, LU, MC, NL, PT, SE, SK. TR), OAPI patent (BF,
BJ, CF CG. CI, CM, GA, GN, GQ, GW. ML, MR NE SN,
TD, TG)
— as to the applicant 's entitlement to claim the priority of the
earlier application (Rule 4.I7(iii))forall designations
Published:
— without international search report and to be republished
upon receipt of that report
For two-letter codes and other abbreviations, refer to the "Guid-
ance Notes on Codes and Abbreviations " appearing at the begin-
ning of each regular issue of the PCT Gazette.
O
m ■ ■ ■ ^ —
O (54) Title: USE OF IL-19, IL-22 AND IL-24 TO TREAT HEMATOPOIETIC DISORDERS
O
(57) Abstract: The present invention relates to a method of using a mammalian gene sequence and polypeptides encoded thereby
to treat mammalian hematopoietic disorders.
wo 03/089569
PCT/US02/31599
-1-
USE OF IL-19, IL-22 AND IL-24 TO TREAT HEMATOPOIETIC DISORDERS
Field of the Invention
The present invention relates to recombinant DNA technology as applied to the
field of human medicine. In particular, the invention relates to methods of treating or
preventing hematopoietic disorders that comprise the administration of IL-19, IL-22 or
IL-24 to patients in need of such treatment.
Background of the Invention
Hematopoiesis is an essential, lifelong process whereby highly specialized blood
cells are generated, including cells responsible for carbon dioxide and oxygen transport
(erythrocytes), blood clotting (platelets), humoral immunity (B lymphocytes), cellular
immunity (T lymphocytes), as well as cells which respond to foreign organisms and their
products (granulocytes, monocytes, and macrophages). All of these cells can be
functionally divided into two distinct groups termed myeloid and lymphoid. During ■
normal adult life, myeloid cells are
produced exclusively within the bone marrow, while cells of the lymphoid lineage are
produced to varying degrees in the bone marrow, spleen, thymus, and lymph nodes.
Mature functional end cells and their immediate precursors have a limited life-span and a
limited proliferative capacity and hence are not self-maintaining. Thus, these cells are
continuously replaced from a pool of more primitive prohferating cells. Ultimately, 'all
cells of both the myeloid and lymphoid hneage are derived from totipotent stem cells.
Hematopoiesis is necessarily tightly regulated. Hematopoietic cytokine action
results in hematopoietic stem cell proliferation and differentiation, ultimately into the
hematopoietic cells: red blood cells, platelets, granulocytes and monocytes.
Development of a single cell type from a stem cell may require the coordinated action of
a plurality of cytokines acting in the proper sequence.
Interleukin-20 (IL-20) is a recently described IL-lO-related cytokine (International
Patent Publications WO 99/27103 and WO 00/12708). The IL-20 coding sequence maps
to human chromosome lq32. This is the same region to which the genes encoding EL-IO,
IL-19 and IL-24 map, which are also IL-lO-related cytokines. IL-20 has been described
to have hematopoietic activity (U.S. Patent Application Number 60/272,242; Filed
wo 03/089569
PCT/US02/31599
-2-
Pebruary 28, 2001 incorporated herein by reference). IL-22 activates the JAK-STAT
signaling pathway and modestly inhibits E.-14 production. Also, there are elevated IL-22
mRNA levels in stimulated T-cells. The biological activities of IL-24 and IL-19 are not
well understood. U.S. Patent 5,985,614 teaches the nucleotide and amino acid sequences
5 encoding human IL-19, Reference 3, listed hereinbelow, teaches the nucleotide and
amino acid sequences encoding IL-22.
Cytokine receptors are composed of one or more integral membrane proteins that
bind a cytokine with high affinity and transduce the binding event into the cell through
the cytoplasmic portions of the receptor subunits. Class n cytokine receptors, such as
1 0 those that bind IL-19, IL-20, IL-22 and IL-24, are typically heterodimers composed of
two distinct receptor chains, the a and p chains. The class n cytokine receptor subunits
are not always exclusive to the binding of a single type of cytokine. For example, the IL-
10 receptor complex is composed of IL-lORa and IL-IORP, while IL-22 also uses IL-
lORp in combination with IL-22R in its receptor complex. IL-20, IL-24 and IL-i9 all
1 5 have been shown to bind the receptor complex composed of IL-20Ra and IL-20RP (1).
Both IL-24 and IL-20 also bind to a receptor complex composed of IL-22R and IL-20RP
(1).
Hematopoietic cytokines have been successfully used in mammals to treat various
diseases arising from imbalances between degradation and reconstitution of blood cells or
2 0 from generation of inappropriate numbers of certain blood cells. For example,
recombinant erythropoietin (EPO) is a glycoprotein administered for the treatment of
anemia in chronic renal failure patients, zidovudine-treated HIV-infected patients, cancer
patients on chemotherapy, and recently, patients receiving autologous transfusions.
Recombinant thrombopoietin (TPO) is currently undergoing evaluation for treatment of
2 5 thrombocytopenia, thrombopoiesis and anemia.
In spite of the availability of EPO and TPO, there remains a particular need to
provide additional methods of altering the hematopoietic state of an individual. There is
a particular need for proteins able to stimulate production of one, or more than one, type
of hematopoietic cell. Accordingly, the present invention provides novel methods of
3 0 treatment that can improve or prevent an undesired hematopoietic condition in a patient.
wo 03/089569
PCTAJS02/31599
Summary of the Invention
The present invention provides a method for modulating hematopoiesis, including
erythropoiesis (production of red blood cells), leukopoiesis (production of white bipod
cells) and/or thrombocytopoiesis (production of platelets) that comprises administering a
5 therapeutically-effective amount of a pharmaceutical composition comprising,
(alternatively, consisting of) at least one IL-19 agonist, IL-22 agonist, IL-24 agonist, IL-
19 antagonist, K,-22 antagonist, IL-24 antagonist, lL-19 polypeptide, IL-22 polypeptide,
IL-24 polypeptide or variant thereof, as defined herein, to a cell, tissue, organ, mammal,
or patient, preferably a human, in need of such therapy to modulate hematopoietic
10 activity.
One embodiment of the present invention is a method for using a therapeutically
effective amount of at least one purified and isolated IL-19, IL-22, or IL-24 agonist,
polypeptide or variant thereof to treat a mammal or patient, preferably a human, in need
of a method for increasing hematopoietic cells.
15 Another embodiment of the present invention is a method for using a
therapeutically effective amount of at least one purified and isolated IL-19, IL-22 or IL-
24 antagonist to treat a mammal, human or patient in need of a method for decreasing
hematopoietic cells.
20 BRIEF DESCRIPTION OF THE FIGURES
Figure 1 represents the nucleotide sequence encoding human IL-19 (SEQ ID No. 1).
Figure 2 represents the amino acid sequence of human IL-19 with the signal sequence
underlined (SEQ ID No. 2). Amino acids about 25-177 represent the mature form of IL-
19.
2 5 Figure 3 represents the nucleotide sequence encoding human IL-22 (SEQ ID No. 3).
Figure 4 represents the amino acid sequence of human IL-22 with the signal sequence
underlined (SEQ ID No. 4). Amino acids about 28-179 represent the mature form of IL-
22.
Figure 5 represents the nucleotide sequence encoding human IL-24 (SEQ ID No. 5).
3 0 Figure 6 represents the amino acid sequence of human iL-24 with the signal sequence
underlined (SEQ ID No. 6). Amino acids about 26-206 represent the mature form of IL-
24.
wo 03/089569
PCTrtJS02/31599
Detailed Description of the Invention
The invention is not limited to the particular embodiments described below, as
variations may be made and still fall within the scope of the appended claims. The
5 terminology used herein is for the purpose of describing particular embodiments, and is
not intended to be limiting. Instead, the scope of the present invention will be established
by the appended claims.
Definitions
The term "amino acid" is used herein in its broadest sense, and includes naturally
10 occurring amino acids as well as non-naturally occurring amino acids, including amino
acid variants and derivatives. The latter includes molecules containing an amino acid
moiety. Reference herein to an amino acid includes, for example, naturally occurring
proteogenic L-amino acids; D-amino acids; chemically modified amino acids such as
amino acid variants and derivatives; naturally occurring non-proteogenic amino acids
15 such as norleucine, P-alanine, ornithine, etc.; and chemically synthesized compounds
having properties known in the art to be characteristic of amino acids.
The incorporation of non-natural amino acids, including synthetic non-native
amino acids, substituted amino acids, or one or more D-amino acids into an IL-19
agonist, IL-22 agonist, IL-24 agonist, IL-19 antagonist, IL-22 antagonist, IL-24
2 0 antagonist, IL-19 polypeptide, IL-22 polypeptide, IL-24 polypeptide or a variant of IL-19
agonist, IL-22 agonist, IL-24 agonist, IL-19 antagonist, IL-22 antagonist, IL-24
antagonist, IL-19 polypeptide, IL-22 polypeptide, IL-24 polypeptide (collectively
referred to herein as "polypeptides of the invention") is advantageous in that they exhibit
increased stability in vitro or m vivo compared to L-amino acid-containing counterparts.
2 5 D-peptides are resistant to endogenous peptidases and proteases, thereby providing
improved bioavailability of the molecule, and prolonged lifetimes in vivo. When it is
desirable to allow the polypeptide of the invention, to remain active for only a short
period of time, the use of L-amino acids therein will permit endogenous peptidases,
proteases, etc., to digest the molecule, thereby limiting the cells exposure to the molecule.
3 0 Additionally, D-amino acid containing polypeptides, cannot be processed efficiently for
major histocompatibility complex class Il-restricted presentation to T-helper cells, and
are less likely to induce humoral immune responses in a whole organism.
wo 03/089569
PCT/US02/31599
In addition to using D-amino acids, those of ordinary skill in the art are aware that
modifications in the amino acid sequence of an IL-19, IL-22 or IL-24 polypeptide can
result in functional polypeptides that display equivalent or superior functional
characteristics when compared to that of a protein having the original polypeptide
5 sequence as shown in SEQ ID NOS: 2, 4 and 6 respectively. Thus, the methods of the
present invention contemplate alterations in IL-19, IL-22 or IL-24 polypeptides or
variants thereof that may include one or more amino acid insertions, deletions,
substitutions, truncations, fusions, shuffling of subunit sequences, and the like, either
from natural mutations or from artificial manipulation, provided that the sequences
1 0 produced by such modifications have substantially the same (or improved or reduced, as
may be desirable) activity(ies) as the unmodified polypeptides. Most preferably a
modified polypeptide for use in the method of the invention ixas a sequence that is at least
about 95% homologous to SEQ ID NOS: 2, 4 or 6, (preferably to the mature form of the
polypeptide without the signal sequence). Even more preferably a modified polypeptide
15 for use in the method of the invention has a sequence that is at least about 96%, 97%,
98%, or 99% homologous to SEQ ID NOS: 2, 4 or 6 (preferably to the mature form of the
polypeptide without the signal sequence).
The term "antagonist" is used in the broadest sense and includes any molecule
that partially or fully blocks, inhibits, or neutralizes a biological activity of a polypeptide
2 0 of interest. In a similar manner, the term "agonist" is used in the broadest sense and
includes any molecule that induces or increases the expression, stability, and/or
biological activity of a polynucleotide or polypeptide of interest.
The term "functional" in reference to an IL-19, IL-22, or rL-24 polypeptide or
variant thereof is intended to mean that the particular molecule exhibits biological
2 5 activities, in vivo or in vitro, that are similar or identical to, or better than, the biological
activities attributable to the IL-19, IL-22, or IL-24 polypeptides (with sequence shown in
SEQ ID NOS: 2, 4, 6 respectively), as' disclosed herein i.e., the ability to induce the
growth and/or differentiation of hematopoietic progenitor cells.
The term "hematocrit" refers to a measurement of the ratio of the volume of red
3 0 blood cells to the volume of whole blood cells as determined by any instrument used in
determining the relative amounts of plasma and corpuscles in blood. It is understood that
hematocrit targets will vary from one individual to another such that physician discretion
wo 03/089569 PCTAJS02/31599
-6-
may be appropriate in determining an actual target hematocrit for any given patient.
Nonetheless, determining a target hematocrit is well within the level of skill in the art.
The term "IL-19 composition" refers to a composition of matter comprising of, or
alternatively, consisting at least one IL-19 agonist, IL-19 antagonist, IL-19 polypeptide,
5 IL-19 variant as defined herein and useful in the method of the invention. Likewise, the
term "IL-22 composition" refers to a composition of matter comprising of, or
alternatively, consisting of at least one IL-22 agonist, IL-22 antagonist, IL-22
polypeptide, IL-22 variant useful in the method of the invention. Likewise, "IL-24
composition" refers to a composition of matter comprising of, or alternatively, consisting
10 of at least one IL-24 agonist, IL-24 antagonist, IL-24 polypeptide. IL-24 variant for use in
the method of the invention. The IL-19, IL-22 and IL-24 polypeptides in compositions of
the invention are preferably the mature form of the proteins, or variants thereof, without
the signal sequence.
The terai "IL-19 variant" as used herein refers to an rL-19 polypeptide (whose
15 sequence is shown in SEQ ID NO: 2) that further comprises at least one of the various
types of modifications contemplated herein. Furthermore, IL-19 variant, as applied to a
polypeptide, is intended to refer to a "functional" IL-19 polypeptide, as defined herein,
having at least about 95% amino acid sequence identity with an IL-19 polypeptide having
the deduced amino acid sequences as shown in SEQ ID NO: 2 (with or without the signal
2 0 peptide). Such IL-19 polypeptide variants include, for instance, IL-19 polypeptides
wherein one or more amino acid residues are added, substituted or deleted, at the N- or C-
terminus or within the sequence of SEQ ID NO: 2.
The term "IL-22 variant" as used herein refers to an IL-22 polypeptide (whose
sequence is shown in SEQ ID NO: 4) that further comprises at least one of the various
25 types of modifications contemplated herein. Furthermore, IL-22 variant, as applied to a
polypeptide, is intended to refer to a "functional" rL-22 polypeptide, as defined herein,
having at least about 95% amino acid sequence identity with an IL-22 polypeptide having
the deduced amino acid sequence shown in SEQ ID NO: 4 (with or without the signal
peptide). Such IL-22 polypeptide variants include, for instance, IL-22 polypeptides
3 0 wherein one or more amino acid residues are added, substituted or deleted, at the N- or C-
terminus or within the sequence of SEQ ID NO: 4.
wo 03/089569
PCT/US02/31599
The term "IL-24 variant" as used herein refers to a TL~24 polypeptide (whose
sequence is shown in SEQ ID NO: 6) that further comprises at least one of the various
types of modifications contemplated herein. Furthermore, JL-24 variant, as applied to a
polypeptide, is intended to refer to a "functional" IL-24 polypeptide, as defined herein,
5 having at least about 95% amino acid sequence identity with an IL-24 polypeptide having
the deduced amino acid sequence shown in SEQ ED NO: 6 (with or without the signal
peptide). Such IL-24 polypeptide variants include, for instance, IL-24 polypeptides
wherein one or more amino acid residues are added, substituted or deleted, at the N- or C-
terminus or within the sequence of SEQ ID NO: 6.
10 More preferably the variant polypeptides for use in the compositions and methods
of the invention have at least about 96% amino acid sequence identity, even more
preferably at least 97%, 98%, or 99% identity with the sequence represented in SEQ ID
NOS: 2, 4 or 6 (Figs. 2, 4, and 6), with or without the signal peptide, but preferably
without.
1 5 The term "inhibit" or "inhibiting" includes the generally accepted meaning
prohibiting, preventing, restraining, slowing, stopping, or reversing progression or
severity of a disease or condition.
The term "mature protein" or "mature polypeptide" as used herein refers to the
form(s) of a protein produced by expression in a mammalian cell. It is generally
2 0 hypothesized that once export of a growing protein chain across the rough endoplasmic
iBticulum has been initiated, proteins secreted by mammalian cells have a signal peptide
(SP) sequence which is cleaved from the complete polypeptide to produce a "mature"
form of the protein. Oftentimes, cleavage of a secreted protein is not uniform and may
result in more than one species of mature protein. The cleavage site of a secreted protein
25 is determined by the primary amino acid sequence of the complete protein and generally
cannot be predicted with complete accuracy. Methods for predicting whether a protein
has a SP sequence, as well as the cleavage point for that sequence, are available. A
cleavage point may exist within the N-terminal domain of IL-19, IL-22 or IL-24 between
amino acid 10 and amino acid 35. The predicted cleavage sites for IL-19, IL-22 and IL-
30 24 signal peptide are shown in Figs 2, 4 and 6. The actual cleavage site may vary by up
to about 6 amino acids on either side of the predicted cleavage site. As one of ordinary
skill would appreciate, cleavage sites sometimes vary from organism to organism and
wo 03/089569
PCT/US02/31599
cannot be predicted with absolute certainty. Optimally, cleavage sites for a secreted
protein are determined experimentally by arnino-terminal sequencing of the one or more
species of mature proteins found within a purified preparation of the protein.
The term "recombinant DNA expression vector" or "expression vector" as used
5 herein refers to any recombinant DNA cloning vector, for example a plasmid or phage, in
which a promoter and other regulatory elements are present thereby enabling
transcription of an operably linked DNA, which may encode a protein.
The term "isolated" when used in relation to a nucleic acid or protein, means the
material is identified and separated from at least one contaminant with which it is
1 0 ordinarily associated in its natural source. Such a nucleic acid could be part of a vector
and/or such nucleic acid or protein could be part of a composition, and still be isolated in
that such vector or composition is not part of its natural environment.
As used herein, the term "piirified" means the result of any process that removes
from a sample a contaminant from the component of interest, such as a protein or nucleic
15 acid. The percent of a purified component is thereby increased in the sample.
The term "increasing hematopoietic cells" is used herein to denote the restoration
or enhanced recovery of hematopoietic cells following their ablation such as ablation
resulting from diseasei disorder or therapeutic intervention.
The term "treatment" or "treating" as used herein describes the management and
2 0 care of a patient for the purpose of combating or preventing a disease, condition, or
disorder and includes the administration of at least one 01,-19, E.-22 or IL-24 agonist, E^-
19, IL-22 or JL-24 antagonist, isolated and purified IL-19, IL-22 or IL-24 polypeptide or
variant thereof, or a composition comprising (or altematively, consisting of or essentially
consisting of) IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, isolated
2 5 and purified IL- 19, IL-22 or IL-24 polypeptide or variant thereof to prevent the onset of
the symptoms or complications, alleviating the symptoms or complications, or
eliminating the disease, condition, or disorder as further defined herein for a mammal,
human or patient in need of such treatment. An example of "preventive therapy" is the
prevention or lessened targeted pathological condition or disorder. Those in need of
3 0 treatment include those already with the disorder or disease as well as those prone to have
the disorder or disease or those in whom the disorder or disease is to be prevented.
wo 03/089569
PCT/US02/31599
"Active" or "activity" in the context of variants of the polypeptides of the
invention refers to retention of a biologic function of the polypeptide of the invention
and/or the ability to bind to a receptor or ligand much as would an unmodified
polypeptide of the invention. More specifically, "biological activity" refers to a
5 biological function (either inhibitory or stimulatory) caused by a reference polypeptide.
Exemplary biological activities include, but are not limited to, the ability of such
molecules to induce or inhibit infiltration of inflammatory cells (e.g., leukocytes) into a
tissue, to induce or inhibit adherence of a leukocyte to an endothelial or epithelial cell, to
stimulate or inhibit T-cell proliferation or activation, to stimulate or inhibit cytokine
10 , release by cells or to increase or decrease vascular pemieability.
' Administration "in combination with" one or more further therapeutic agents includes
simultaneous (concurrent) and consecutive administtation in any order.
A "therapeutically-effective amount" is the minimal amount of active agent (e.g.,
an LP polypeptide) necessary to impart therapeutic benefit to a mammal, i.e., an amount
15 that induces, ameliorates or otherwise causes an improvement in the pathological
symptoms, disease progression, physiological conditions associated with or resistance to
succumbing to the aforedescribed disorder.
Overview
It has been shown that upon exposure to IL-20 polypeptides in combination with
2 0 human EPO and human stem cell factor, human CD34+ progenitor cells proliferate and
differentiate markedly. Also, addition of IL-20 polypeptides greatiy increased the sizes
of erythroid progenitors (see U.S. Patent Application Number 60/272,242; Filed
2/28/2001, incorporated herein). Here, applicants teach that isolated and purified
polypeptides of the invention (mature IL-19 polypeptide, IL-22 polypeptide, IL-24
2 5 polypeptide and variants thereof) demonstrate the ability to stimulate proliferation and
differentiation of a hematopoietic progenitor cell. A preferred embodiment of the
invention is a method of using at least one isolated and purified mature JL-19, IL-22 or
IL-24 polypeptide or variant thereof for the purpose of stimulating proliferation of greater
than one type of hematopoietic progenitor cell (e.g.,a progenitor of red blood cells and a
3 0 progenitor of platelets). Another embodiment of the invention is a method of using at
least one IL-19, IL-22 or IL-24 agonist for the purpose of stimulating proliferation of
wo 03/089569
PCT/US02/31599
-10-
greater than one type of hematopoietic progenitor cell (e.g., a progenitor of red blood
cells and a progenitor of platelets).
Further described herein is activity of IL-19, IL-22 and IL-24 closely associated
with hematopoietic processes. Therefore, the present invention provides methods of
5 treating or preventing hematopoietic disorders including, but not limited to, the
administration of a therapeutically effective amount of a pharmaceutical composition
comprising of, or alternatively consisting of or consisting essentially of, at least one IL-
19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof to a
mammal, human or patient in need of such treatment to increase hematopoietic cells.
1 0 Such methods are useful for enhancing or stimulating hematopoiesis, erythropoiesis,
leukopoiesis, fhrombocytopoiesis, production of neutrophils, granulocytes, and/or
platelets by stimulating the proliferation and/or differentiation of progenitors of such
cells, as needed in various conditions and/or situations, including, but not limited to, the
following:
15 (a) inadequate platelet production, such as aplastic anemia, refractory anemias,
leukemia, preleukemia/ myelodysplastic syndromes, megaloblastic anemia,
chemotherapy or radiation therapy, and existing platelet deficiency or an expected
platelet deficiency (e. g., because of planned surgery including, but not limited to,
organ/bone marrow transplantations); ,
2 0 (b) increased destmction of platelets, such as idiopathic thrombocytopenia
purpura, other immune thrombocytopenias, IV-associated thrombocytopenia,
sepsis/disseminated intravascular coagulation, and vasculitis;
(c) abnormal platelet function, such as Glanzmann' s thrombasthenia,
acute/chronic leukemia, myeloproliferative disorders, uremia, platelet storage pool
2 5 disease. Von Willebrand disease, and postoperative cardiovascular dysfunction, and
(d) other blood coagulation disorders such as afibrinogenemia or wounds of any
origin.
The generic term for platelet deficiency is thrombocytopenia, and hence the
methods and compositions of the present invention are generally available for treating
3 0 thrombocytopenias. Thrombocytopenias (platelet deficiencies) may be present for
various reasons, including chemotherapy, radiation therapy, surgery, accidental blood
loss, and other specific disease conditions. Exemplary specific disease conditions that
wo 03/089569
PCT/US02/31599
-11-
involve thrombocytopenia and may be treated in accordance with this invention are:
aplastic anemia, idiopathic thromboc)rtopenia, and certain metastatic tumors which result
in thrombocytopenia. Also, certain treatments for AIDS result in thrombocytopenia (e.g.,
AZT). Certain wound healing disorders might also benefit from an increase in platelet
5 numbers.
With regard to anticipated platelet deficiencies, (e.g., due to future surgery), at
least one isolated and purified IL-19, IL-22 or IL-24 agonist, polypeptide, or variant
thereof, could be administered several days to several hours prior to the need for platelets.
With regard to acute situations, e.g., accidental and massive blood loss, at least one IL-
10 19, IL-22 or IL-24 agonist, polypeptide, or variant thereof, could be administered along
with blood or purified platelets or other cytokines, further described herein.
The present invention also provides methods of treating or preventing
hematopoietic disorders including, but not limited to, the administration of a
therapeutically effective amount of a pharmaceutical composition comprising of, or
1 5 alternatively consisting of or consisting essentially of, at least one IL-19, IL-22 or IL-24
antagonist to a mammal, human or patient in need of such treatment to decrease
hematopoietic cells.
Furthermore, the present invention provides an IL-19, IL-22 or IL-24 agonist,
antagonist, polypeptide or variant thereof, and compositions comprising, or alternatively
2 0 consisting of at least one IL-19, IL-22 or IL-24 agonist, antagonist, polypeptide or variant
thereof that modulate intracellular signaling pathways dependent on at least one of the
following: hematopoietic, erythropoietic, leukopoietic or throfflbopoietic related function.
IL-19, IL-22 or IL-24 molecules (i.e., agonists, antagonists, polypeptides and variants
thereof) and/or IL-19, IL-22 or IL-24 compositions can stimulate (agonists, polypeptides
25 and variants thereof) or inhibit (antagonists) T-cell activation and/or proliferation and,
thereby, have therapeutic utility for treating infections caused by viruses including, but
not limited to, HIV and have therapeutic utility for treating various autoimmune diseases
including, but not limited to, rheumatoid arthritis, lupus, graft versus host, host versus
graft, insulin-dependent diabetes, autoimmune encephlo-myelitis, and multiple sclerosis.
3 0 A preferred embodiment of the present invention provides methods of treating or
preventing hematopoietic disorders including, but not limited to, anemia and disorders
commonly associated with anemia comprising the administration to a mammal, human,
wo 03/089569
PCT/US02/31599
-12-
or patient in need of such treatment a therapeutically effective amount of a
pharmaceutical composition comprising an isolated IL-19, IL-22 or IL-24 agonist,
polypeptide, or variant thereof, comprising (alternatively consisting of, alternatively
consisting essentially of) at least one an IL-19 agonist, Ej-22 agonist, IL-24 agonist, IL-
5 19 polypeptide, IL-22 polypeptide, IL-24 polypeptide or a variant thereof.
A preferred embodiment of the present invention also provides methods of
treating or preventing hematopoietic disorders such as anemia and/or disorders associated
vs^ith anemia comprising the administration of a therapeutically effective amount of a
pharmaceutical composition comprising (alternatively consisting of or consisting
10 essentially of) an IL-19, IL-22 or IL-24 agonist, polypeptide or variant thereof as defined
herein to a mammal or patient, preferably a human, in need of such treatment.
A preferred embodiment of the present invention provides a method of treating or
preventing hematopoietic disorders including, but not limited to, erythrocytosis, and/or
leukemia comprising the administration of a therapeutically effective amount of a
1 5 pharmaceutical composition comprising a IL- 19, IL-22 or IL-24 antagonist to a mammal,
preferably a human, in need of such treatment.
The present invention further provides a pharmaceutical formulation that
comprises (alternatively consists of or consists essentially of (i.e., less than about 10%
impurities)) at least one IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist,
20 IL-19, IL-22 or IL-24 polypeptide or variant thereof mdJoi IL-19, IL-22 or IL-24
composition together with one or more pharmaceutically acceptable diluents, carriers, or
excipients therefor.
The present invention also provides a method of treating or preventing
hematopoietic disorders including, but not hmited to, anemia and/or disorders commonly
25 associated with anemia, comprising the administration to a mammal, human or patient in
need thereof of a therapeutically effective amount of an IL-19, IL-22 or IL-24
composition wherein said composition has at least one activity, such as, but not limited
to, inducing differentiation and/or proliferation of erythroid and/or megakaryocyte
progenitor cells. An IL-19, IL-22 or IL-24 polypeptide can be screened for a
3 0 corresponding activity according to these effects.
The invention further provides for the use of at least one IL- 1 9, IL-22 or IL-24
agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant
wo 03/089569
PCTmS02/31599
-13-
thereof, in the manufacture of a medicament for the treatment or prevention of anemia,
leukemia and disorders associated with such conditions.
Variants
Reference to a particular polypeptide sequence disclosed in SEQ ID NOS: 2, 4 or
6, with or without the signal peptide sequence as shown in Figs. 2, 4 and 6 (i.e., a
"polypeptide of the invention") as well as fusion proteins comprising polypeptides of the
invention is also understood to include variants of the polypeptide as defined herein. The
term "variant" refers to a polypeptide differing from a polypeptide of the present
invention, but retaining essential properties thereof. Generally, variants are closely
similar overall in structural and/or sequence identity, and, in many regions, identical to
polypeptide of the present invention.
The present invention is also directed to polypeptides that comprise, or
alternatively consist of, an amino acid sequence that is at least: 95%, 96%, 97%, 98%,
99% identical to a polypeptide sequence of SEQ ID NOs: 2, 4 or 6 (with or without the
signal peptide sequence as depicted in Figs. 2, 4 and 6).
A polypeptide exhibiting or having at least about, e.g., 95% "sequence identity" to
another amino acid sequence may include, e.g., up to five amino acid alterations per each
100 amino acid (on average) stretch of the test amino acid sequence. In other words, a
first amino acid sequence that is at least 95% identical to a second amino acid sequence,
can have up to 5% of its total number of amino acid residues different from the second
sequence, e.g., by insertion, deletion, or substitution of an amino acid residue.
Alterations in amino residues of a polypeptide sequence may occur at the amino
or carboxy terminal positions or anywhere between these terminal positions, interspersed
either individually among residues in the sequence or in one or more contiguous
fragments within the sequence. As a practical matter, whether any particular polypeptide
sequence exhibits at least about: 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, or
99% similarity to another sequence, can be determined conventionally by using known
methods in the art.
The phrase "percent (%) identity" with respect to the amino acid sequences
identified herein is defined as the percentage of amino acid residues in a candidate
sequence that are identical with the amino acid residues in a reference polypeptide
wo 03/089569
PCT/US02/31599
-14-
sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the
maximum percent sequence identity, and not considering any conservative substitutions
as part of the sequence identity. Alignment for purposes of determining percent amino
acid sequence identity can be achieved in various ways that are within the skill in the art,
for instance, using publicly available computer software such as ALIGN, ALIGN-2,
Megalign (DNASTAR) or BLAST (e.g., Blast, Blast-2, WU-Blast-2) software. Those
skilled in the art can determine appropriate parameters for measuring alignment,
including any algorithms needed to achieve maximal alignment over the full length of the
sequences being compared. For example, the % identity values used herein are generated
using WU-BLAST-2 [Altschul, et al. Methods in Enzvmology 266: 460-80 (1996)].
Most of the WU-BLAST-2 search parameters are set to the default values. Those not set
to default values, i.e., the adjustable parameters, are set with the following values:
overlap span = 1; overiap fraction = 0.125; word threshold (T) = 11; and scoring
matrix = BLOSUM 62. For purposes herein, a % amino acid sequence identity value is
determined by dividing (a) the number of matching identical amino acid residues between
the amino acid sequence of the hSEZ6 polypeptide of interest and the comparison amino
acid sequence of interest (i.e., the sequence against which the hSEZ6 polypeptide of
interest is being compared) as determined by WU-BLAST-2, by (b) the total number of
amino acid residues of the polypeptide of interest.
Variants may be produced by mutagenesis techniques or by direct synthesis using
known methods of protein engineering and recombinant DNA technology. Such variants
may be generated to improve or alter the characteristics of the polypeptide or the
expression levels or may occur unintentionally. One or more amino acids can often be
■deleted from the N-terminus or C-terminus of a secreted polypeptide without a substantial
loss of biological function. Moreover, ample evidence demonstrates that polypeptide
variants can retain a biological activity similar to that of the naturally occurring protein.
Even if deleting one or more amino acids from the N-terminus or C-terminus of the
polypeptide results in modification or loss of one or more biological functions, other
biological activities may be retained.
Variants of the polypeptides of the invention can be generated through DNA
shuffling as disclosed, for example, by Intemational Patent Application WO 97/20078
and U.S. patents 6,303,344 and 6,297,053.
wo 03/089569
PCT/US02/31599
-15-
The invention also encompasses polypeptide variants that show a biological
activity of the reference polypeptide such as, e.g., ligand binding or antigenicity. Such
variants include, e.g., deletions, insertions, inversions, repeats, and substitutions selected
so as to have little effect on activity using general rules known in the art.
One technique compares amino acid sequences in different species to identify the
positions of conserved amino acid residues since changes in an amino acid at these
positions are more likely to affect a protein function. In contrast, the positions of
residues where substitutions exist more frequent generally indicate that amino acid
residues at these positions are less critical for a protein function. Thus positions
tolerating amino acid substitutions typically may be modified while still maintaining a
biological activity of a protein.
Another technique uses genetic engineering to introduce amino acid changes at
specific positions of a polypeptide to identify regions critical for a protein function. For
example, site directed mutagenesis or alanine-scanning mutagenesis (the introduction of
single alanine mutations at every residue in the molecule) can be used. A resulting mutant
can subsequently be tested for a biological activity.
These two techniques have revealed that proteins are surprisingly tolerant of
amino acid substitutions and they generally indicate which amino acid changes are likely
to be permissive at certain amino acid positions in a protein. For example, typically,
most buried amino acid residues (those within the tertiary structure of the protein) require
nonpolar side chains, whereas few features of surface side chains are generally
conserved. Preferred conservative amino acid substitutions are listed in Table 1 herein.
Polypeptide variants containing amino acid substitutions of charged amino acids
with other charged or neutral amino acids may produce polypeptides with improved
characteristics e.g., such as less aggregation. Aggregation of pharmaceutical
formulations both reduces activity and increases clearance due to the aggregate's
immunogenic activity.
A further embodiment of the invention encompasses a protein that comprises an
amino acid sequence of the present invention that contains at least one amino acid
substitution, but not more than 15 amino acid substitutions, preferably not more than 10
amino acid substitutions.
wo 03/089569
PCTAIS02/31599
-16-
Of course, in order of ever-increasing preference, it is highly preferable for a
polypeptide of the invention to have an amino acid sequence that comprises an amino acid
sequence of the present invention which contains zero or one, but not more than: 10, 9, 8, 7,
6, 5, 4, 3, 2, or 1 amino acid substitutions; wherein conservative amino acid substitutions are
5 more preferable than non-conservative substitutions.
The novel methods contemplated by the present invention are intended to include
methods of using IL-19, IL-22 or IL-24 polypeptides with a sequence as shown in SEQ
ID NOS: 2, 4, and 6, respectively (preferably without the signal sequence), as well as
active polypeptide Variants thereof that further comprise one or more substitutions,
1 0 deletions, insertions, inversions, additions yet have substantially similar or better
biological activities and/or pharmaceudcally desired properties as the corresponding
unmodified IL-19, IL-22 or IL-24 polypeptide.
In one embodiment of the present invention, a single amino acid change is made
within the IL-19, IL-22 or IL-24 polypeptide that has a sequence as shown in SEQ ID
15 NOs: 2, 4 or 6 respectively (with or without the signal sequence). Alternatively, at least
two changes are made within at least one of these polypeptide sequences; alternatively, at
least three changes are made within at least one of these polypeptide sequences;
alternatively, at least four changes up to at least 10 changes are made within at least one
of these polypeptide sequences. As the skilled artisan understands, many substitutions,
2 0 and/or other changes to a protein's sequence or structure, can be made without
substantially affecting the biological activity or characteristics of the polypeptide. For
example, making conservative amino acid substitutions, or changing one amino acid for
another from the same class of amino acids, for example, negatively charged residues,
positively charged residues, polar uncharged residues, and non-polar residues, or any
2 5 other classification acceptable in the art, are often made without significant effects upon
function. Modifications of the IL-19, IL-22 or IL-24 polypeptide with a sequence as
shown in SEQ ID NO: 2, 4 or 6 respectively (with or without the signal sequence) made
in accordance with Table I hereinbelow are expected to result in variant polypeptides that
retain the same or substantially similar or even better biological activity as the
3 0 unmodified polypeptide based on art recognized substitutability of certain amino acids
and are also contemplated as being useful in the methods of the present invention. ■
wo 03/089569
PCT/US02/31599
-17-
TABLE I
ORIGINAL RESIDUE
EXEMPLARY SUBSTITUTIONS
ALA
SER, THR
ARG
LYS
ASN
HIS, SER
ASP
GLU, ASN
CYS
SER
GLN
ASN, ms
GLU
ASP, GLU
GLY
ALA, SER
fflS
ASN, GLN
TT.F.
LEU, VAL, THR
LEU
ILE, VAL
LYS
ARG, GLN, GLU, THR
MET
LEU, HJE, VAL
PHE
LEU, TYR
SER
THR, ALA, ASN
THR
SER, ALA
TRP
ARG, SER
TYR
PHE
VAL
TLB, LEU, ALA
PRO
ALA
One factor that can be considered in making such changes is the hydropathic
index of amino acids. The importance of the hydropathic amino acid index in conferring
interactive biological function on a protein has been discussed by Kyte and Doolittle (2).
5 It is accepted that the relative hydropathic character of amino acids contributes to the
secondary structure of the resultant protein. This, in turn, affects the interaction of the
protein with molecules such as enzymes, substrates, receptors, ligands, DNA, antibodies,
antigens, etc. Based on its hydrophobicity and charge characteristics, each amino acid
has been assigned a hydropathic index as follows: isoleucine (+4.5); valine (+4.2);
10 leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+L9); alanine
wo 03/089569
PCTAJS02/31599
-18-
(+1.8); glycine (-0.4); threonine (-0.7)'; serine (-0.8); tryptophan (-0.9); tyrosine (-1.3);
proline (-1.6); histidine (-3.2); glutamate/glutamine/aspartate/ asparagine (-3.5); lysine (-
3.9); and arginine (-4.5).
As is known in the art, certain amino acids in a peptide, polypeptide, or protein
can be substituted for other amino acids having a similar hydropathic index or score and
produce a resultant peptide, etc., having similar biological activity, i.e., which still retains
biological functionality. In making such changes, it is preferable that amino acids having
hydropathic indices within +2 are substituted for one another. More preferred
substitutions are those wherein the amino acids have hydropathic indices within +1.
Most preferred substitutions are those wherein the amino acids have hydropathic indices
within ±0.5.
Like amino acids can also be substituted on the basis of hydrophilicity. U.S.
Patent No. 4,554,101 discloses that the greatest local average hydrophilicity of a protein,
as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological
property of the protein. The following hydrophilicity values have been assigned to amino
acids: arginine/lysine (+3.0); aspartate/glutamate (+3.0+1); serine (+0.3);
asparagine/glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5+1);
alanine/histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);
leucine/isoleucine (1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4).
Thus, one amino acid in a peptide, polypeptide, or protein can be substituted by another
amino acid having a similar hydrophilicity score and still produce a resultant peptide,
etc., having similar biological activity, i.e., still retaining correct biological function. In
making such changes, amino acids having hydropathic indices within +2 are preferably
substituted for one another, those within ±1 are more preferred, and those within +0.5 are
most preferred.
As outlined above, amino acid substitutions in an IL-19, IL-22 or IL-24
polypeptide can be based on the relative similarity of the amino acid side-chain
substituents, for example, their hydrophobicity, hydrophilicity, charge, size, etc.
Exemplary substitutions that take various of the foregoing characteristics into
consideration in order to produce conservative amino acid changes resulting in silent
changes within the present peptides, etc., can be selected from other members of the class
wo 03/089569
PCT/US02/31599
-19-
to which the naturally occurring amino acid belongs. Amino acids can be divided into
the following four groups: (1) acidic amino acids; (2) basic amino acids; (3) neutral polar
amino acids; and (4) neutral non-polar amino acids. Representative amino acids within
these various groups include, but are not limited to: (1) acidic (negatively charged) amino
acids such as aspartic acid and glutamic acid; (2) basic (positively charged) amino acids
such as arginine, histidine, and lysine; (3) neutral polar amino acids such as glycine,
serine, threonine, cysteine, cystine, tyrosine, asparagine, and glutamine; and (4) neutral
non-polar amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine,
tryptophan, and methionine.
IL-22 or IL-24 variants having biological activities, in vivo or in vitro, that
are similar or identical to those described herein, for example, the ability to induce or
enhance differentiation and/or proliferation of erythroid and/or megakaryocyte progenitor
cells are also useful in the methods of the present invention and as such are contemplated
by the present invention. IL-19, IL-22 or IL-24 variants, while being functionally related,
by definition include amino acid sequences that differ in one or more positions from the
sequence as shown in SEQ ID NOs: 2, 4 and 6 respectively (with or without the signal
sequence). Variants that are useful in the methods of the present invention can be
generated by deletion, insertion, inversion, and/or substitution of one or more amino acid
residues in said IL-19, IL-22 or IL-24 polypeptide. Such variants can generally be made
by solid phase or recombinant techniques in which, for example, single or multiple
conservative amino acid substitutions are made, according to Table 1. Generally, in the
case of multiple substitutions, it is preferred that between 95% to 100% of the residues of
an IL-19, IL-22 or IL-24 variant are identical to the corresponding contiguous sequence
as shown in SEQ JD NOs: 2, 4, or 6 respectively (with or without the signal sequence); it
is more preferable that between 96% to 100% of the residues of an IL-19, IL-22 or IL-24
variant are identical to the coixesponding contiguous sequence as shown in SEQ ID NO: ■
2, 4, or 6 respectively (with or without the signal sequence); most preferably between
98% to 100% of the residues of a IL-19, IL-22, or IL-24 variant are identical to the
corresponding contiguous sequence as shown in SEQ ID NO: 2, 4 or 6 respectively (with
or without the signal sequence).
Another class of variant that may be useful in the methods of the present
invention includes IL-19, IL-22 or IL-24 polypeptides as defined herein further
wo 03/089569
PCTAJS02/31599
-20-
comprising at least one oligopeptide or amino acid added onto the N-terminus and/or C-
terminus. An "oligopeptide" is a chain of from 2 to about 250 amino acids connected at
their N- and/or C-termini by peptide bonds. Suitable oligopeptides and amino acids are
those that do not significantly decrease the biological activity of the polypeptide as
5 defined herein and do not substantially detract from the desired pharmaceutical and
pharmacological properties of the polypeptide. A preferred example of such a
modification includes an IL-19, IL-22 or IL-24 polypeptide as defined herein further
(SEQ ID NOs: 2, 4, or 6 respectively) comprising a leader sequences found in other
polypeptides, such as pretrypsinogen leader sequence.
1 0 The IL-19, IL-22, or IL-24 polypeptides as defined herein can also be expressed
and used in a modified form, such as a fusion protein or a "tagged" protein. IL-19, IL-22,
or IL-24 fusion proteins represent a hybrid protein molecule not found in nature
. comprising a translational fusion or enzymatic fusion in which two or more different
proteins, fragments, or variants thereof are covalently linked on a single polypeptide
1 5 chain. Human serum albumin, the C-terminal domain of thrombopoietin, the C-terminal
extension peptide of hCG, and/or a Fc fragment are examples of proteins which could be
fused with IL-19, IL-22, or IL-24 polypeptides or variants thereof for use in the present
invention. As used herein, "Fc fragment" of an antibody has the meaning commonly
given to the term in the field of immunology. Specifically, this term refers to an antibody
2 0 fragment which binds complement and is obtained by removing the two antigen binding
regions (the Fab Fragments) from the antibody. Thus, the Fc fragment is formed from
approximately equal sized fragments from both heavy chains, which associate through
non-covalent interactions and disulfide bonds. The Fc Fragment includes the hinge
regions and extends through the Ch2 and Ch3 domains to the C-terminus of the antibody.
25 In a preferred process for protein expression and subsequent purification, the IL-
19, IL-22, or IL-24 gene (sequence as shown in SEQ ID NOs: 1, 3, 5 respectively) can be
modified at the 5' end to encode several histidine residues at the amino terminus of the
protein resulting from its expression. This "histidine tag" enables a single-step protein
purification method referred to as "immobilized metal ion affinity chromatography"
3 0 (IMAC), essentially as described in U.S. Patent 4,569,794. The IMAC method enables
rapid isolation of substantially pure recombinant protein starting from a crude extract of
cells that express a modified recombinant protein, as described above.
wo 03/089569
PCT/US02/31599
-21-
Synthesis
Functional fragments of IL-19, IL-22, or JL-24 polypeptides and variants thereof
may be generated by any number of suitable techniques, including chemical synthesis of
any portion of SEQ JD NOs: 2, 4 or 6, proteolytic digestion of IL-19, IL-22 or IL-24
polypeptides, propolypeptides or variants thereof, or most preferably, by recombinant
DNA mutagenesis techniques well known to the skilled artisan. For example, in a
preferred method, a nested set of deletion mutations are introduced into a nucleic acid
sequence encoding a IL-19, IL-22 or IL-24 polypeptide such that varying amounts of the
protein coding region are deleted, either from the amino terminal end or from the
carboxyl end of the protein molecule. This method can also be used to create internal
fragments of the intact protein in which both the carboxyl and amino terminal ends are
removed. Several appropriate nucleases can be used to create such deletions, for example
Bal 31 or mung bean nuclease. If desired, the resulting gene deletion fragments can be
subcloned into any suitable vector for propagation and expression in any suitable host
cell, bacterial, yeast, insect or mammalian.
Functional fragments of the proteins or full-length proteins disclosed herein may
be produced as described above or using techniques well known in the art. Such proteins
may be tested for biological activity using any suitable assay, for example, the ability to
induce and/or enhance differentiation and/or proliferation of erythroid progenitor cells in
vivo or in vitro.
Those skilled in the art will recognize that the gene encoding IL-19, IL-22 or IL-
24 could be obtained by a plurality of recombinant IDNA techniques including, for
example, hybridization, polymerase chain reaction (PGR) amplification, or de novo DNA
synthesis (4). Methods for constructing cDNA libraries in a suitable vector such as a
plasmid or phage for propagation in prokaryotic or eukaryotic cells are well known to
those skilled in the art. (4). Suitable cloning vectors are well known and are widely
available.
The IL-19, IL-22 or IL-24 gene, or any fragment thereof, can be isolated from a
tissue in which said gene is expressed, for example, placenta. In one method, mRNA is
isolated, and first strand cDNA synthesis is carried out. A second round of DNA
synthesis can be carried out for the production of the second strand. If desired, the
double-stranded cDNA can be cloned into any suitable vector, for example, a plasmid,
wo 03/089569
PeT/US02/31599
-22-
thereby forming a cDNA library. Oligonucleotide primers targeted to any suitable region
of SEQ ID NO: 1, 3, or 5 for DL-19, IL-22 or IL-24 respectively can be used for PGR
amplification. The PGR amplification comprises template DNA, suitable enzymes,
primers, and buffers, and is conveniently carried out in a DNA Thermal Cycler (Perkin
Elmer Cetus, Norwalk, CT). A positive result is determined by detecting an
appropriately-sized DNA fragment following agarose gel electrophoresis. The proteins
used in the present invention can be synthesized by a number of different methods, such
as chemical methods well known in the art, including solid phase peptide synthesis or
recombinant methods.
The proteins useful in the present invention can be produced by numerous means
including recombinant DNA methods using the cloned IL- 1 9, IL-22 or IL-24 gene.
Recombinant methods are preferred if a high yield is desired. Expression of the cloned
gene can be carried out in a variety of suitable host cells, well known to those skilled in
the art. For this purpose, the IL-19, IL-22 or IL-24 gene is introduced into a host cell by
any suitable means. While chromosomal integration of the cloned gene is within the
scope of the present invention, it is preferred that the gene be cloned into a suitable exti-a-
chromosomally maintained expression vector so that the coding region of the gene is
operably-linked to a constitutive or inducible promoter.
The basic steps in the recombinant production of IL-19, IL-22 or IL-24 protein or
variant thereof are:
a) constructing a natural, synthetic or semi-synthetic DNA encoding
said protein or variant thereof;
b) integrating the DNA into an expression vector in a manner suitable
for expressing the protein or variant thereof, either alone or as a fusion protein;
c) transforming or otherwise introducing said vector into an
appropriate eukaryotic or prokaryotic host cell forming a recombinant host cell,
d) culturing said recombinant host cell in a manner to express the IL-
19, IL-22 or IL-24 protein or or variant thereof; and
e) recovering and substantially purifying the EL- 19, IL-22 or IL-24
protein or variant thereof by any suitable means, well known to those skilled in
the art.
wo 03/089569
PCT/US02/31599
-23-
Vectors suitable to cairy the nucleic acids of the present invention comprise RNA
viruses, DNA viruses, lytic bacteriophages, lysogenic bacteriophages, stable
bacteriophages, plasmids, viroids, and the like. The most preferred vectors are plasmids.
When preparing an expression vector the skilled artisan understands that the
5 amount of nucleic acid or protein to be produced dictates, in part, the selection of the
expression system. Regarding promoter sequences, inducible promoters are preferred
because they enable high level, regulatable expression of an operably-linked gene. Other
relevant considerations regarding an expression vector include whether to include
sequences for directing the localization of a recombinant protein. For example, a
1 0 sequence encoding a signal peptide preceding the coding region of a gene is useful for
directing the extra-cellular export of a resulting polypeptide.
As previously mentioned, the IL-19, IL-22 or IL-24 polypeptides used in the
methods of the present invention may be synthesized either by direct expression or as a
fusion protein comprising the protein of interest as a translational fusion with another
1 5 protein or peptide which may be removable by enzymatic or chemical cleavage. It is
often observed in the production of certain peptides in recombinant systems that
expression as a fusion protein prolongs the life span, increases the yield of the desired
peptide, or provides a convenient means of purifying the protein. This is particularly
relevant when expressing mammalian proteins in prokaryotic hosts. A variety of
2 0 peptidases (e.g. enterokinase and thrombin) which cleave a polypeptide at specific sites
or digest the peptides from the amino- or carboxy-termini (e.g. diaminopeptidase) of the
peptide chain are known. Furthermore, particular chemicals {e.g. cyanogen bromide) will
cleave a polypeptide chain at specific sites.
Exemplary mammalian host cells suitable for use in the present invention include,
2 5 but are not limited to, HepG-2 (ATCC HB 8065), CV-1 (ATCC CCL 70), LC-MK2
(ATCC CCL 7.1), 3T3 (ATCC CCL 92), CHO-Kl (ATCC CCL 61), HeLa (ATCC CCL
2), RPMI8226 (ATCC CCL 155), H4IIEC3 (ATCC CCL 1600), C127I (ATCC CCL
1616), HS-Sultan (ATCC CCL 1484), and BHK-21 (ATCC CCL 10). Transfection of
mammalian cells with vectors can be performed by a plurality of well-known processes
3 0 including, but not limited to, protoplast fiision, calcium phosphate co-precipitation,
electroporation and the like (4). The recombinantly-produced protein may be purified
from cellular extracts of transformed cells by any suitable means.
wo 03/089569
PCT/US02/31599
-24-
The IL-19, lL-22 and IL-24 cDNA (sequence shown in SEQ JD NO: 1, 3 and 5
respectively shown in Figs. 1, 3 and 5) and related nucleic acid molecules that encode
SEQ ID NO: 2, 4, or 6, or variants thereof (with or without the signal peptide sequence),
may be produced by chemical synthetic methods. Fragments of the DNA sequence
corresponding to the gene of interest may be generated using a conventional DNA
synthesizing apparatus, such as the Applied Biosystams Model 380A or 380B DNA
synthesizers (Applied Biosystems, Inc. Foster City, CA) using phosphoramidite
chemistry, thereafter ligating the fragments so as to reconstitute the entire gene.
Alternatively, phosphotriester chemistry may be employed to synthesize the nucleic acids
of this invention (7).
In an alternative methodology, namely PGR, the DNA sequences disclosed and
described herein, comprising, for example, a portion or all of SEQ ID NO: 1, 3 or 5 can
be produced from a plurality of starting materials. For example, starting with a cDNA
preparation derived from a tissue that expresses the IlL-19, IL-22 or IL-24 gene. Using
PGR, any region of the IL-19, IL-22 or IL-24 gene can be targeted for amplification such
that full or partial length gene sequences may be produced.
Signal Sequence
• The polypeptides of the invention may have a signal peptide sequence to enable
protein transport within the cell (Figs 2, 4 and 6); however, this signal peptide sequence is
not present in the mature polypeptides as they exist when transported outside the cell.
Alternatively, the polypeptide of the invention may be made without a signal peptide
sequence. Either way, the mature polypeptide does not possess the signal peptide sequence.
A signal peptide,' comprised of about 10-30 hydrophobic amino acids, targets the
nascent protein from the ribosome to the endoplasmic reticulum (ER). Once localized to
the ER, the proteins can be further directed to the Golgi apparatus within the cell. The
Golgi distributes proteins to vesicles, lysosomes, the cell membraine, and other
organelles. Proteins targeted to the ER by a signal sequence can be released from the cell
into the extracellular' space. Vesicles containing proteins to be moved outside the cell can
fuse with the cell membrane and release their contents into the extracellular space via a
process called exocytosis. Exocytosis can occur constitutively or after receipt of a
triggering signal. In the latter case, the proteins are stored in secretory vesicles until
wo 03/089569
PCTAIS02/31599
-25-
exocytosis is triggered. Proteins that transit through this pathway are either released into
the extracellular space or retained in the plasma membrane.
The conunon Structure of signal peptides from various proteins is typically described
as a positively charged n-region, followed by a hydrophobic h-region and a neutral but polar
5 c-region. The (-3 , -1) rule states that the residues at positions -3 and -1 (relative to the
signal peptide cleavage site) must be small and neutral for cleavage to occur correctly.
In many instances the amino acids comprising the signal peptide are cleaved off the
protein during transport or once its final destination has been reached. Specialized enzymes,
signal peptidases, are responsible for the removal of the signal peptide sequences from
1 0 proteins. These enzymes are activated once the signal peptide has directed the protein to the
desired location.
Polypeptides of the present invention may be produced recombinantly. In
general, the signal sequence may be a component of an expression vector, or it may be a
part of the DNA encoding the polypeptide of the invention that is inserted into such a
15 vector. For E.coli expression, the signal sequence may be a prokaryotic signal sequence
selected, for example, from the group of the alkaline phosphatase, penicillinase, Ipp, or
heat-stable enterotoxin H leaders. For yeast secretion the signal sequence may be, e.g.,
the yeast invertase leader, alpha factor leader (including Saccharomyces and
Kluyveromyces cc-factor leaders, the latter described in U.S. Patent No. 5,010,182), or
2 0 acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179), or the signal
. described in WO 90/13646. In mammalian cell expression, mammalian signal sequences
may be used to direct secretion of the protein, such as signal sequences from secreted
polypeptides of the same or related species as well as viral secretory leaders.
The usefulness of a IL-19, IL-22 or iL-24 agonist, IL-19, IL-22 or IL-24
2 5 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof, or a composition
comprising, or alternatively consisting of or essentially consisting of, at least one IL-19,
IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, isolated and purified IL-19, IL-
22 or IL-24 polypeptide or variant thereof for the purpose of modifying a hematopoietic
disorder in a mammal, human, or patient in need of such treatment can be determined by
3 0 one skilled in the art without undue experimentation by application of the methods or
assays described herein or otherwise known in the art. Similarly, the usefulness of an IL-
19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24
wo 03/089569
PCT/US02/31599
-26-
polypeptide or variant thereof, or a composition comprising, or alternatively consisting of
or essentially consisting of, at least one rL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-
24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof, of the present
invention in the methods of the present invention can be assessed or quantified using the
5 in vitro models or in vivo models of hematopoiesis as described herein (see Examples) or
assays otherwise known in the art.
Cell-based systems can be used to identify compounds that may act to ameliorate
hematopoietic disorder symptoms. Such cell systems can include, for example,
recombinant or non-recombinant cell, such as cell lines, that express the IL-19, IL-22 or
1 0 IL-24 gene. In utilizing such cell systems, cells that express IL-19, IL-22 or IL-24 may be
exposed to a compound suspected of exhibiting an ability to ameliorate hematopoietic
disorder symptoms, at a sufficient concentration and for a sufficient time to elicit such an
amelioration of such symptoms in the exposed cells.
After exposure the cells can be assayed to measure alterations in the expression of the IL-
1 5 19, IL-22 or IL-24 gene, e.g., by assaying cell lysates for IL-19, IL-22 or IL-24 mRNA
transcripts or for IL-1 9, IL-22 or IL-24 gene products expressed by the cell.
In addition, animal-based systems or models for a mammalian hematopoietic
disorder, for example, transgenic mice containing a human or altered form of IL-19, IL-
22 or IL-24 gene, may be used to identify capable of ameliorating symptoms of the
2 0 disorder. Such animal models may be used as test substrates for the identification of
drugs, pharmaceuticals, therapies and interventions. For example, animal models may be
exposed to a compound suspected of exhibiting an ability to ameliorate symptoms, at a
sufficient concentration and for a sufficient time to ehcit such an amelioration of the
symptoms of the hematopoietic disorder. An animal's response to a particular treatment
2 5 may be monitored by assessing reductions in the symptoms attributable to the disorder.
Treatments that favorably affect hematopoietic disorder-like symptoms may be
considered as candidates for human therapeutic intervention in such a disorder. Dosages
of test agents may be determined by deriving dose-response curves
In one embodiment, methods of the present invention comprise contacting a
3 0 compound to a cell, measuring the level of IL-19, IL-22 or IL-24 gene expression, gene
product expression, or gene product activity, and comparing the level to the level of IL-
19, IL-22 or IL-24 gene expression, gene product expression, or gene product activity
wo 03/089569
PCT/US02/31599
-27-
produced by the cell in the absence of the compound. If the level obtained in the
presence of the compound differs from that obtained in its absence, a compound that
modulates the expression of the mammalian E.-19, IL-22 or IL-24 gene and/or the
synthesis or activity of mammalian n.-19, IL-22 or IL-24 gene products has been
5 identified.
In an alternative embodiment, methods of the present invention comprise
administering a compound to a host, and measuring the level of IL-19, IL-22 or IL-24
gene expression, gene product expression, or gene product activity. The measured level
is compared to the level of IL-19, IL-22 or IL-24 gene expression, gene product
10 expression, or gene product activity in a host that is not exposed to the compound, If the
level obtained when the host is exposed to the compound differs from that obtained when
the host is not exposed to the compound, a compound that modulates either the
expression of the mammalian IL-19, IL-22 or IL-24 gene, the synthesis or activity of the
IL-19, IL-22 or IL-24 gene product, the compound may be used in the methods of the
15 present invention.
Methods of the present invention can comprise, for example, administering
compounds which modulate the expression of a mammalian IL-19, IL-22 or rL-24 gene
and/or the synthesis and/or the activity of a mammalian IL-19, IL-22 or IL-24 gene
product, so that symptoms of a hematopoietic disorder are ameliorated. Alternatively, in
2 0 those instances whereby the mammalian hematopoietic disorder results from IL-19, IL-22
or IL-24 gene mutations, such methods can comprise supplying the mammal with a
nucleic acid molecule encoding an unimpaired IL-19, IL-22 or IL-24 gene product such
that an unimpaired IL-19, IL-22 or IL-24 gene product is expressed and symptoms of the
disorder are ameliorated.
2 5 For therapeutic utility, an effective amount of at least one IL-19, IL-22 or IL-24
agonist, IL-19, IL-22 or IL-24 antagonist, isolated and purified IL-19, rL-22 or IL-24
polypeptide or variant thereof, or a composition comprising, or alternatively consisting of
or consisting essentially of, an effective amount of at least one IL-19, IL-22 or IL-24
agonist, rL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant
3 0 thereof is administered to a mammal, human or patient in need thereof in a dose between
about 0. 1 and 1 000 ^ig/kg. In practicing the methods contemplated by this invention, the
IL-19, IL-22 or IL-24 agonists, IL-19, IL-22 or IL-24 antagonists, IL-19, rL-22 or IL-24
wo 03/089569
PCTAJS02/31599
-28-
polypeptides or variants thereof, or compositions comprising, or alternatively consisting
of or consisting essentially of at least one IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or
IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof as defined herein
can be administered in multiple doses per day, in single daily doses, in weekly doses, or
5 at any other regular interval. The amount per administration and frequency of
administration will be determined by a physician and depend on such factors as the nature
and severity of the disease, and the age and general health of the patient.
The present invention also provides a pharmaceutical IL-19, IL-22, or IL-24
' composition comprising as the active agent an IL-19, IL-22 or IL-24 agonist, IL-19, IL-
10 22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof and a
pharmaceutically acceptable solid or liquid carrier. For example, at least one IL-19, IL-
22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide
or variant thereof can be admixed with conventional pharmaceutical carriers and
excipients, and used in the form of tablets, capsules, elixirs, suspensions, syrups, wafers,
1 5 parenteral formulations, and the like. The compositions will contain from about 0. 1% to
90% by weight of at least one active IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24
antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof and more generally from
. about 10% to 30%. The compositions may contain common carriers and excipients such
as corn-starch or gelatin, lactose, sucrose, raicrocrystalline cellulose, kaolin, mannitol,
2 0 dicalcium phosphate, sodium chloride, and alginic acid.
As a general proposition, the total pharmaceutically effective amount of at least
one IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-
24 polypeptide or variant thereof administered parenterally to a patient per dose will be in
the range of about 1 (xg/kg/day to 10 mg/kg/day, particularly 2 mg/kg/day to 8
2 5 mg/kg/day, more particularly 2 mg/kg/day to 4 mg/kg/day, even more particularly 2.2
mg/kg/day to 3.3 rag/kg/day, and finally 2.5 mg/kg/day, although, as noted above, this
will be subject to therapeutic discretion. More preferably, this dose is at least 0.01
mg/kg/day. If given continuously a IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24
antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof is typically administered
30 at a dose rate of about 1 |Ag/kg/hour to about 50 )j,g/kg/hour, either by 1-4 injections per
day or by continuous subcutaneous infusions, for example, using a mini-pump. An
intravenous bag solution may also be employed. The length of treatment needed to
wo 03/089569
PCT/US02/31599
-29-
observe changes and the interval following treatment for responses to occur appears to
vary depending on the desired effect.
Pharmaceutical compositions comprising at least one IL-19, IL-22 or IL-24
agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant
thereof may be administered orally, rectally, intracranially, parenterally, intracistemally,
intravaginally, intraperitoneally, topically (as by powders, ointments, drops or
transdermal patch), transdermally, intrathecally, bucally, or as an oral or nasal spray. By
"pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or Uquid
filler, diluent, encapsulating material or formulation auxiliary of any type. The term
"parenteral" as used herein includes, but is not limited to, modes of administration which
include intravenous, intramuscular, intraperitoneal, intrastemal, subcutaneous and intra-
articular injection, infusion and unplants comprising (alternatively consisting of or
consisting essentially of) at least one IL-19, IL-22 or rL-24 agonist, IL-19, IL-22 or IL-24
antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof.
The compounds caii be fonnulated for oral or parenteral administration. A
preferred parenteral formulation for subcutaneous administration would comprise a
buffer (e.g., phosphate, citrate, acetate, borate, TRIS), salt (e.g., NaCl, KCl), divalent
metal (e.g., Zn, Ca), and isotonicty agent (e.g., glycerol, mannitol), detergent (e.g.,
polyoxyethylene sorbitan fatyy acid esters, poloxamer, ddicusate sodium, sodium lauryl
sulfate), antioxidants (e^g., ascorbic acid), and antimicrobial agent (e.g., phenol, m-cresol,
alcohol, benzyl alcohol, butylparben, methylparaben, ethylparaben, chlorocresol,
phenoxyethano],phenylethyl alcohol, propylparaben).
For intravenous (IV) use, at least one IL-19, IL-22 or IL-24 agonist, IL-19, IL-22
or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof is administered
in commonly used intravenous fluid(s) and administered by infusion. Such fluids, for
example, physiological saline. Ringer's solution or 5% dextrose solution can be used.
For intramuscular preparations, a sterile formulation, preferably a suitable soluble
salt form of at least one IL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist,
IL-19, IL-22 or IL-24 polypeptide or variant thereof such as the hydrochloride salt, can
be dissolved and administered in a pharmaceutical diluent such as pyrogen-free water
(distilled), physiological saline, or a 5% glucose solution. A suitable insoluble form of
the compound may be prepared and administered as a suspension in an aqueous base or a
wo 03/089569
PCTAJS02/31599
-30-
pharmaceutically acceptable oil base, e.g. an ester of a long chain fatty acid such as ethyl
oleate.
An lL-19, IL-22 or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22
or IL-24 polypeptide or variant thereof is also suitably administered by sustained-release
5 systems. Suitable examples of sustained-release compositions include semi-permeable
polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained-
release matrices include, but are not limited to, polylactides (U.S. Pat. No. 3,773,919, EP
58,481). Other sustained-release compositions also include liposomally entrapped
modified IL-19, ILr22 or IL-24 polypeptides or variants thereof. Such liposomes are
1 0 prepared by methods known for example: U.S. Pat. Nos. 4,485,045 and 4,544,545; and
EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms)
unilamellar type in which the lipid content is greater than about 30 mol percent
cholesterol, the selected proportion being adjusted for the optimal therapy.
For parenteral administration, in one embodiment, the IL-19, IL-22 or IL-24
1 5 ■ agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22' or IL-24 polypeptide or variant
thereof may be formulated generally by mixing it at the desired degree of purity, in a unit
dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier (i.e., one that is non-toxic to recipients at the dosages and
concentrations employed and is compatible with other ingredients of the formulation).
2 0 Preferably, the formulation does not include oxidizing agents and other compounds that
are known to be deleterious to polypeptides.
Generally, the formulations'are prepared by contacting at least one IL-19, IL-22
or IL-24 agonist, IL-19, IL-22 or IL-24 antagonist, IL-19, IL-22 or IL-24 polypeptide or
variant thereof uniformly and intimately with liquid carriers or finely divided solid
2 5 carriers or both. Then, if necessary, the product is shaped into the desired formulation.
Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic
with the blood of the recipient. Examples of such carrier vehicles include water, saline,
Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and
ethyl oleate are also useful herein, as well as liposomes.
3 0 The carrier suitably contains minor amounts of additives such as substances that
enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at
the dosages and concentrations employed, and include buffers for example phosphate.
wo 03/089569
PCT/US02/31599
-31-
citrate, succinate, acetic acid, and other organic acids or tlieir salts; antioxidants such as
ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g.,
polyarginine or tripeptides; proteins, for example serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, for
5 example glycine, glutamic acid, aspartic acid, or arginine; monosaccharides,
disaccharides, and other carbohydrates including cellulose or its derivatives, glucose,
manose, or dextrins; chelating agents such as EDTA; sugar alcohols for example
mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants for example
polysorbates, poloxamers, or PEG.
10 At least one IL-19, 3L-22 or IL-24 agonist, IL-19, lL-22 or IL-24 antagonist, IL-
19, IL-22 or IL-24 polypeptide or variant thereof is typically fomulated in such vehicles
at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of
about 3 to 8. It will be understood that the use of certain of the foregoing excipients,
carriers, or stabiUzers will result in the formation of salts of the particular active
15 ingredient(s).
■ Compositions to be used for therapeutic administration must be sterile. Sterility is
readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron
membranes). Therapeutic compositions generally are placed into a container having a
sterile access port, for example, an intravenous solution bag or vial having a stopper
2 0 pierceable by a hypodermic injection needle.
Pharmaceutically useful IL-19, IL-22 or IL-24 compositions ordinarily will be
stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an
aqueous solution or as a lyophilized formulation for reconstitution. As an example of a
lyophilized formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v)
2 5 aqueous solution of one of an IL-19, IL-22 or IL-24 composition, and the resulting
mixture is lyophihzed. The infusion solution is prepared by reconstituting the lyophilized
polypeptide using bacteriostatic Water-for-Injection,
The invention also provides a pharmaceutical pack or kit comprising one or more
containers filled with one or more of the ingredients of the pharmaceutical compositions
30 of the invention. Associated with such container(s) can be a notice in the form prescribed
by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or
wo 03/089569
PCT/US02/31599
biological products, which notice reflects approval by the agency of manufacture, use or
sale for human administration.
In addition the therapeutic methods of the present invention may also be
employed, alone or in combination with other cytoMnes, soluble Mpl receptor,
5 hematopoietic factors, interleukins, growth factors, chimeras thereof (e.g., myelopoietin)
or antibodies thereto or in combination with any of the soluble receptors or augmentors
thereof in the treatment of hematopoietic disease states. It is anticipated that the inventive
therapeutic methods will prove useful in treating some forms of thrombocytopenia,
anenaia, leukemia, bone marrow transplant, and in combination with general stimulators
10 of hematopoiesis, such as IL-3 or GM-CSR Other megakaryocytic stimulatory factors,
i.e., meg-CSF, stem cell factor (SCF), leukemia inhibitory factor (LIF), oncostatin M
(OSM), or other molecules with megakaryocyte stimulating activity may also be
employed with at least one IL-19, IL-22 or E.-24 agonist, IL-19, IL-22 or IL-24
antagonist, IL-19, IL-22 or IL-24 polypeptide or variant thereof. Additional exemplary
1 5 cytokines or hematopoietic factors for such co-administration include: IL- 1 alpha, IL- 1
beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, EL-10, IL-11, IL-12, IL-13, IL-14, IL-
15, IL-16, lL-17, IL-18, IL-20, colony stimulating factor-1 (CSF-1), M-CSF, SCF, GM-
CSF, granulocyte colony stimulating factor (G-CSF), EPO, interferon-alpha (IFN-alpha),
consensus interferon, IFN-beta, IFN-gamma, thrombopoietin (TPO), angiopoietins, e.g.,
2 0 Ang-1 , Ang-2, Ang-4, Ang-Y, the human angiopoietin-like polypeptide, vascular
endothelial growth factor (VEGF), angiogenin, bone morphogenic protein-1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14 or 15, bone morphogenic protein receptor la, bone
morphogenic protein receptor lb, brain derived neurotrophic factor, ciliary neutrophic
factor, ciliary neutrophic factor receptor, epidermal growth factor, epithelial-derived
2 5 neutrophil attractant, fibroblast growth factor 4, 5, 6, 7, 8, 8a, 8b, 8c, 9 or 10, fibroblast
growth factor acidic, fibroblast growth factor basic, glial cell line-derived neutrophic
factor receptors, heparin binding epidermal growth factor, hepatocyte growth factors,
hepatocyte growth factor receptors, insulin-like growth factor 1, insulin-like growth
factor receptors, insulin-like growth factor 11, insulin-like growth factor binding protein,
3 0 keratinocyte growth factor, leukemia inhibitory factor, leukemia inhibitory factor
receptor a, nerve growth factor, nerve growth factor receptors, neurotrophin-3,
neurotrophin-4, placenta growth factor, placenta growth factor 2, platelet-derived
wo 03/089569
PCTAJS02/31599
-33-
endothelial cell growth factor, platelet derived growth factors including, but not limited
to, platelet derived growth factor A chain, platelet derived growth factor AA, platelet
derived growth factor AB, platelet derived growth factor B chain, platelet derived growth
factor BB, and platelet derived growth factor receptors, pre-B cell growth stimulating
5 factor, stem cell factor receptor, tumor necrosis factors, including TNFO, TNFI, TNF2,
transforming growth factor u, transforming growth factor P, transfonning growth factor
PI, P1.2, P2, P3 or P5, latent transfonning growth factor PI, transfonning growth factor
P binding protein 1, transforming growth factor P binding protein 2, transforming growth
factor P binding protein 3, tumor necrosis factor receptor type 1, tumor necrosis factor
1 0 receptor type 2, urokinase-type plasminogen activator receptor, vascular endothelial
growth factor, and chimeric proteins and biologically or immunologically active
fragments thereof. It may further be useful to administer, either simultaneously or
sequentially, an effective amount of a soluble mammalian Mpl receptor, which appears to
have an effect of causing megakaryocytes to fragment into platelets once the
15 megakaryocytes have reached mature form. Thus, administration of an IL- 19, IL.-22 or
IL-24 composition in combination with at least one of the additional factors provided
hereinabove in combination with administration of the soluble Mpl receptor (to inactivate
the ligand and allow the mature megakaryocytes to produce platelets) is expected to be a,
particularly effective means of stimulating platelet production. The dosage recited above
2 0 would be adjusted to compensate for such additional components in the therapeutic
composition. Administration in combination with one or more further therapeutic agents
includes simultaneous (concurrent) and consecutive administration in any order.
Progress of the treated patient can be monitored by assays provided herein or otherwise
known in the art.
2 5 The following examples more fully describe the present invention. Those skilled
in the art will recognize that the particular reagents, equipment, and procedures described
are merely illustrative and are not intended to limit the present invention in any manner.
EXAMPLES
30 Example 1: Transgenic Rodent Development
A. Transgene construction.
wo 03/089569
PCT/US02/31599
-34-
Polymerase chain reaction (PGR) primers are synthesized according to standard
methods and used to separately amplify the IL-24 coding region and the IL-19 coding
region from plasmids containing the full length coding region plus surrounding sequences
or from genomic DNA:
5 For IL-24 an exemplary set of PGR primers are:
5' GAGACTGAGAGATGAATITTG 3' (SEQ ID NO. 7)
5' GACATTCAGAGCTTGTAGAATTTC 3' (SEQ ID NO. 8)
For IL- 19 an exemplary set of PGR primers are:
5' CAAGTGAGAGGCATGAAGTTAC 3' (SEQ ID NO. 9)
10 5' CCTTGTCATCAAGCTGAGGAC 3' (SEQ ID NO. 10)
For IL-22 an exemplary set of PGR primers may be found in Reference 3. Many
alternative PGR primer sets may be designed by one skilled in the art. The primers may
incorporate restriction enzyme sites to accommodate cloning into a plasmid.
15 B . Transgenic animal development.
Transgenic mice were generated using established techniques [Hogan, B. et al.
(1986) Manipulating the Mouse Embryo: A Laboratory Manual. Gold Spring Harbor
Laboratory, NY] as modified by Ref . 8. Briefly, a 6.4 kb DNA fragment encompassing
the human apolipoprotein E (hApoE) gene promoter-5' hApoE untranslated region-IL-
20 19, IL-22 OR IL-24/FLAG-hepatic control region (HCR) fusion gene is excised from
plasmid pLIV? -IL-19, IL-22 OR IL-24 by digestion with Sal I and Spe I and purified by
gel electrophoresis and glass bead extraction. The purified DNA fragment encompassing
the hApoE gene promoter-5' hApoE untranslated region-(IL-19, IL-22 or IL-24)-HCR
fusion gene is microinjected into the male pronuclei of newly fertilized one-cell-stage
25 embryos (zygotes) of the FVB/N strain. The embryos are cultured in vitro overnight to
allow development to the two-cell-stage. Two-cell embryos are then transplanted into the
oviducts of pseudopregnant IGR strain mice to allow development to term. To test for the
presence of the transgene in the newborn mice, a small piece of toe is removed from each
animal and digested with proteinase K to release the nucleic acids. A sample of the toe
3 0 extract is subsequently subjected to PGR analysis using primers specific for the hApoE
untranslated region to identify transgene containing mice. Five founder transgenic mice
wo 03/089569
PCT/US02/31599
-35-
are identified for each gene. Each of these founders is bred to produce Fl and F2
progeny.
Example 2: In Vitro Testing for Hematopietic Modulators
A. Human Megakaryocyte Assay
Test polypeptides (e.g., IL-19, IL-22 and IL-24 polypeptides) can be assayed for
their ability to stimulate development of human megakaryocytes from CD34+ progenitor
cells. CD34+ selected cells are obtained from bone marrow (9) and are incubated in
Iscove's modified Dulbecco's medium (MDM; GEBCO) with 2 mM Glutamine, 2-
mercaptoethanol (10"'' M), 1% bovine serum albumin, low density lipoprotein (40 \xg/mi,
Sigma); bovine pancreatic insulin (10 jig/ml), human transferrin (200 ng/ml), human
recombinant thrombopoietin (50 ng/ml, R&D Systems); human recombinant stem cell
factor (50 ng/ml, R&D Systems), human recombinant IL-3 (10 ng/ml, R&D System) and
1.1 mg/ml collagen. CD34+ cells are plated at 3300-cells/ml final concentrations on 2
well chamber slides. Cells are incubated at 37°C for 12 days in humidified boxes in 5%
CO2 in air, fixed directly to the culture wells with 1:3 methanohacetone solution, and
incubated with a monoclonal antibody, anti-GPHb/IIIa, (StemCell Technologies,
Vancouver, Canada). The immune reaction was developed with biotin-conjugated goat
anti-mouse IgG followed by avidin-alkaline phosphatase conjugate, identified by pink
color, are counted with an inverted phase microscope at lOOX magnification. Results are
presented as the average number of megakaryocytes per well +/- standard error of the
mean (SEM).
B. Proliferation/Differentiation Activity of IL-19, IL-22 and IL-24 Polypeptides
on Human Hematopoietic Progenitors
Human bone marrow CD34+ cells from Poietic, BioWhittaker are incubated in
Iscove's modified Dulbecco's medium CI^/[DM; GIBCO) supplemented with 0.9%
Methylcellulose, 2 mM Glutamine, 2-mercapto-ethanol (10"* M), 1% bovine serum
albumin, bovine pancreatic insulin (10 Dg/ml), human transferrin (200 Dg/ml) and
various concentration of human stem cell factor, IL-3, EPO, and GM-CSF. CD34+ cells
are plated at 1000 cells/ml final concentration in 35-mm dishes. Cells are incubated at
37°C for 14-16 days in 5% COain air. Colonies are scored under an inverted microscope.
wo 03/089569
PCT/US02/31599
-36-
Treatment with test po]ypeptide(s) (e.g.,IL-22, IL-19, JL-2A polypeptide) (200 ng/ml)
may result in colony size increase.
C. Assay for Liquid Bone Marrow Culture
5 CD34+ human bone marrow cells are purchased from Poietic, BioWhittaker and
incubated in Iscove's modified Dulbecco's medium (MDM; GIBCO) supplemented with
30% fetal bovine serum, antibiotics, 2 mM Glutamine, 2-mercapto-ethanol (10"^ M), and
various concentrations of human stem cell factor, EL-3, EPO and/or GM-CSF. CD34+
cells are plated in U-bottomed 96 well plates at 5000 cells/well and cultured at 37 °C, 5%
1 0 CO2 for 10 days with a breathable membrane to prevent evaporation. Feeding occurs at
days 4 and 7 by replacing 80% of the medium with fresh medivmi. At day 10, the cells
are transferred to V-bottomed plates and stained for CD41 (FITC) and CD36 (PE). CeUs
are then acquired on a flow cytometer in timed acquisition mode and compared to the
negative controls. Treatment with test polypeptide (e.g., IL-19, IL-22, or IL-24
15 polypeptide) (200 ng/ml) may stimulate proliferation of GD34+ cells.
Example 3: In Vivo Testing for Hematopietic Modulators
A. Recovery of Blood Cells after Bone Marrow Transplantation.
Bone marrow is harvested by gentle flushing of the hind limbs of normal 8- to 10-
2 0 week-old Balb-C mice (Harlan Sprague Dawley) using RPMI medium (GIBCO)
containing 10% fetal calf serum. For some experiments, donor mice are pretreated with
5-fluorouracil (5-FU) at 150-mg/kg-body weight intraperitoneally 3 days before
harvesting BM for infusion. After total body irradiation with 10.8 Gy ('^^Cs at
126cGy/min, split dose with a minimum of 3 hours between doses), 1 X 10* bone marrow
2 5 cells are injected intravenously into sub-lethally irradiated mice. The polypeptide to be
tested (250 jxg/kg body weight) is diluted in PBS and injected subcutaneously in 0.2-ml
volume daily starting on the same day as irradiation and infusion of donor bone marrow
cells. Control mice receive the same volume of PBS. Mice are weighed every 2 to 4
days during the post-transplantation period. Hematologic analysis of leukocyte cell
3 0 counts and platelet counts are performed on orbit bleeds on a CDC Mascot™ machine.
Blood smears are stained with Wright-Giemsa using standard methods and examine at
lOOX for differentiation analysis, Peripheral blood hematocrits are performed by
wo 03/089569
PCT/US02/31599
-37-
spinning capillary tubes for 5 minutes in a Model MB Micro-Gapillary Centrifuge.
Accordingly, test polypeptides can be used to accelerate recovery of peripheral blood cell
counts.
B. Recovery of Blood Cells after Combined Chemo-/Radiation Therapy
5 Eight- to ten-week old Balb/C mice (Harlan Sprague Dawley) are administered 5-
fluorouracil at 150-mg/kg body weights intraperitoneally 3 days before sub-lethal
irradiation (0.6 Gy total body irradiation for 20-22 mg mouse). Test polypeptide(s) are
injected sub-cutaneously in 0.2 ml volumes daily starting on the same day as irradiation.
Negative control mice receive the same volume of PBS as the treated mice. Test
10 polypeptide administiation lasts for 14 days. The mice are analyzed at 7 days and 14
days post-radiation. Mice are weighed every 2 to 4 days during the post-radiation period.
Hematologic analysis of leukocyte cell counts and platelet counts are performed on orbit
bleeds on a CDC Mascot™ machine. Blood smears are stained with Wright-Giemsa
using standard methods and examine at lOOX for differentiation analysis. Peripheral
15 blood hematocrits were performed by spinning capillary tubes for 5 minutes in a Model
MB Micro-Capillary Centrifuge. Test polypeptides may be useful in accelerating
recovery of peripheral blood cell counts after chemo-Zradiation therapy
C. Treatment of Anemia
Various animal models of anemia and hematopoietic disorder are known in the art
.2 0 and generally accepted as being indicative of the anemic condition. For instance, the
exhypoxic polycythemic mouse bioassay may be used to quantify the incorporation of 5'
Fe(iron) into newly synthesized red bipod cells as a measure of the increase in
erythropoiesis in mice in response to an exogenously administered test sample The
assay, is described in WO 0024893 (assay herein incorporated by reference).
2 5 The test agent(s) may be adroinistered by any of several routes of administration
(e.g. i.v., s.c, i.p., or by minipump or cannula) and suitable test animals include normal
mice as well as IL-19, IL-2i or IL-24 transgenic mice similar to those described in
Example 1. Controls for non-specific effects for these treatments are done using vehicle
with or without the active agent of similar composition in the same type animal
3 0 monitoring the same parameters.
wo 03/089569
PCT/US02/31599
-38-
Example 4: Proliferation of IL-19. IL-22 or IL-24 Splenocvtes in a Mixed Lymphocyte
Reaction
In a mixed lymphocyte reaction assay, splenocytes from DBAy2 mice (Harlan
Sprague Dawley) may be used as stimulator cells after being treated with mitomycin C.
5 The responder cells are splenocytes isolated from C57BL/6 mice (Harlan Sprague
Dawley) transplanted with the IL-19, IL-22 or IL-24 gene or naive mice. The
suspensions of responder T cells are cultured with allogeneic stimulator lymphocytes.
The activating stimulus is the foreign histocompatibility antigen (usually MHC class I or
class n molecules) expressed on the allogenic stimulator cells.
10 In brief, splenocytes from DBA/2 are added to 96-weIl plates at 1 x 10^ cells per
well in RPMI + 10% FBS and Pen/Strep. Splenocytes from either age matched C57BL/6
naTve mice or retroviral expressed IL-19, IL-22 or IL-24 mice are added as responder
cells to wells at either 0.5, 1, 2, 4, or 8 x 10^ cells per well. Control wells contained DBA
stimulator splenocytes alone or C57BL/6 responder spleenocytes alone. After 72 hours
15 in vitro, wells are pulse labeled with 1 jnCi of tritiated thymidine. After 18 hrs, cells can
be harvested and counted.
Example 5: Proliferation and cytokine secretion of IL-19 IL-22 or IL-24 expressing
splenocvtes upon antigenic stimulation
2 0 Flat bottom 96 well plates are coated with 100 |xl media (RPMI, 10% EBS)
containing 5 fxg/ml a-CD3 . Plates are coated for 1 .5 hrs. at 37°G, aspirated, and washed
2x in PBS. Then, 4 x 10^ spleen cells in a 100 ^il volume of media are added to each well
and plates are incubated for 48 hrs. at 37°C. After plates are centrifuged at 1200 rpm for
5 min., 100 \i\ of supernatant from each well is removed and transferred to 96-well U-
2 5 bottom plates of which 10 \xl is used for the cytokine secretion immunoassay according to
standard procedures. Remainder of cells are pulse-labeled with 1 jJ,Ci of 3H-
thyraidine/well and incubated for another 24 hrs prior to counting. In addition to
activation of splenocytes by anti-GD3, other stimuli can be tested in the same manner.
Preferred stimuli for testing include dilutions of 2.5 ng/ml IL-2, dilutions of 8 ng/xxA
3 0 ConA, dilutions of PMA with 1 \xM ionomycin, and 100 |a.g/ml LPS.
wo 03/089569
PCTAJS02/31599
-39-
Example 6: Exposure of Transgenic Mice to Sub-Lethal Doses of Radiation
Wild type and transgenic mice of both genders are irradiated at 600 cGy. The
mice are analyzed at 3, 7, 10 days and 14 days post-radiation. Mice are weighed every 2
days during the post-radiation period. Hematologic analysis of leukocyte cell counts and
5 platelet counts are performed on orbit bleeds on a CDC Mascot™ machine. Blood
smears are stained with Wright-Giemsa using standard methods and examine at lOOX for
differentiation analysis. Peripheral blood hematocrits were performed by spinning
capillary tubes for 5 minutes in a Model MB Micro-Capillary Centrifuge. IL-19, IL-22 or
IL-24 may be used to accelerate the recovery of peripheral blood cell counts after
1 0 exposure to sub-lethal doses of radiation.
REFERENCES
1 . Dumoutier, L., et al. J. Immunology. (2001). 167:3545-3549.
2. Kyte and Doolittle. 1982, /. MoZ. BioZ., 157:105-132.
15 3. Dumoutier, et al. Genes and Immunity (2000). 1:488-494.
4. Sambrook, et al. Molecular Cloning: A Laboratory Manual . 2d Ed. Chap. 14 (1989).
5. Smith and Waterman, J. Mol. Biol. (1985). 147:195.
6. Altschul et al. J. Mol. Biol. (1990). 215:403.
7. M.J. Gait, ed., Oligonucleotide Synthesis. A Practical Approach , (1984).
2 0 8. Fox and Solter, Mol.. Cell. Biol. (1988)., 8:5470.
9. Hokom, M.H., Choi, E., Nichol, J.L., Homkohl, A., Arakawa and Hunt, Molecular
Biology of Haematopoiesis (1994). 3:15.
25 '
wo 03/089569
PCT/US02/31599
1 . A method of increasing the number of one or more type(s) of hematopoietic
progenitor cells in a mammal in need thereof comprising administering a therapeutically
effective amount of a polypeptide comprising an amino acid sequence selected from the
group consisting of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, amino acids about
25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ ID NO: 4, and amino acids
about 26-206 of SEQ ID NO: 6.
2. A method of increasing the number of one or more types of mature
hematopoietic cells in a mammal in need thereof comprising administering a
therapeutically effective amount of a polypeptide comprising an amino acid sequence
selected from the group consisting of: SEQ ID NO: 2. SEQ ID NO: 4, SEQ ID NO: 6,
amino acids about 25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ ID NO: 4.
and amino acids about 26-206 of SEQ ID NO: 6.
3. The method of claim 2 wherein the type of mature hematopoietic cells are
selected from the group consisting of red blood cells, granulocytes, monocytes and
platelets.
4. The method of claim 2, wherein the mature hematopoietic cells are red blood
5. A method of increasing hematocrit in a mammal in need thereof comprising
administering a therapeutically effective amount of a polypeptide comprising an amino
acid sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 6, amino acids about 25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ
ID NO: 4, and amino acids about 26-206 of SEQ ID NO: 6.
6. The method of any one of claims 1-5 further comprising administering a
therapeutically effective amount of at least one additional hematopoietic cytokine,
wherein the hematopoietic cytokine is administered prior to, simultaneously with, or
wo 03/089569
PCT/US02/31599
-41-
subsequent to the polypeptide comprising an amino acid sequence selected from the
group consisting of, SEQ ID NO: 2, SEQ ED NO: 4, SEQ ID NO: 6, amino acids about
25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ ID NO: 4, and amino acids
about 26-206 of SEQ ID NO: 6.
7. The method of claim 6 wherein the at least one additional hematopoietic
cytokine is selected from the group consisting of: Epo, TPO, IL-1, IL-3, IL-4, IL-5, IL-7,
IL-9, IL-1 1 , G-CSF, GM-CSF, M-CSF and SCF.
8. A method of decreasing the number of one or more type(s) of hematopoietic
progenitor cells in a mammal in need thereof comprising administering a therapeutically
effective amount of an antibody against a polypeptide comprising an amino acid
sequence selected from the group consisting of, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID
NO: 6, amino acids about 25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ ID
NO: 4, and amino acids about 26-206 of SEQ ID NO: 6.
9. A method for treating or preventing a hematopoietic disorder in a mammal
comprising the administration to said mammal in need of such treatment a
pharmaceutical composition comprising a therapeutically effective amount of at least one
polypeptide comprising an amino acid sequence selected from the group consisting of,
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, amino acids about 25-177 of SEQ ID
NO: 2, amino acids about 28-179 of SEQ ID NO: 4, and amino acids about 26-206 of
SEQ ID NO: 6.
10. The method of claim 9 wherein the method further comprises administration
to said mammal a pharmaceutical composition comprising a therapeutically effective
amount of at least one additional hematopoietic cytokine.
11. The method of claim 10 wherein the hematopoietic cytokine is administered
prior to, simultaneously with, or subsequent to the administration of a polypeptide
comprising an amino acid sequence selected from the group consisting of, SEQ ID NO:
wo 03/089569
PCT/US02/31599
-42-
2, SEQ ID NO: 4, SEQ E) NO: 6, amino acids about 25-177 of SEQ ID NO: 2, amino
acids about 28-179 of SEQ ID NO: 4, and amino acids about 26-206 of SEQ ID NO: 6.
12. Tiie method of claim 1 1 wherein the hematopoietic cytokine is selected from
5 the group consisting of Epo, TPO, lL-1, IL-3, IL-4, IL-5, IL-7, IL-9. IL-11, G-CSF, GM-
CSF,M-CSFandSCF.
13. The method of claim 12 wherein the composition comprising the polypeptide
comprising an amino acid sequence selected from the group consisting of, SEQ ID NO:
10 2, SEQ ID NO: 4, SEQ ID NO: 6, amino acids about 25-177 of SEQ ID NO: 2, amino
acids about 28-179 of SEQ ID NO: 4, and amino acids about 26-206 of SEQ ED NO: 6,
further comprises the additional hematopoietic cytokine.
14. A method for treating or preventing a hematopoietic disorder in a mammal
1 5 comprising the administration to said mammal in need of such treatment a
pharmaceutical composition comprising a therapeutically effective amount a polypeptide
comprising an amino acid sequence selected from the group consisting of, SEQ ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 6, amino acids about 25-177 of SEQ ID NO: 2, amino
acids about 28-179 of SEQ ID NO: 4, and ammo acids about 26-206 of SEQ ID NO: 6.
20
15. The method of claim 14 wherein the niethod further comprises administration
to said mammal a pharmaceutical composition comprising a therapeutically effective
amount of at least one additional hematopoietic cytokine.
2 5 16. The method of claim 15 wherein the hematopoietic cytokine is administered
prior to, simultaneously with, or subsequent to the administration of the LP82
polypeptide.
17. The method of claim 14 wherein the additional hematopoietic cytokine is
3 0 selected from the group consisting of Epo, TPO, EL-l, IL-3, IL-4, IL-5, IL-7, IL-9, IL-11,
G-CSF, GM-CSF, M-CSF and SCR
wo 03/089569
PCT/US02/31599
-43-
18. A phannaceutical composition comprising a hematopoietic progenitor cell-
stimulating amount of a polypeptide comprising an amino acid sequence selected from
the group consisting of, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, amino acids
about 25-177 of SEQ ID NO: 2, amino acids about 28-179 of SEQ ID NO: 4, and amino
5 acids about 26-206 of SEQ ID NO: 6.and a phannaceutically acceptable carrier, diluent
or excipient.
19. The pharmaceutical composition as in claim 18 further comprising at least
one additional hematopoietic cytoidne.
10 ■
20. The pharmaceutical composition as in claim 18, wherein the at least one
additional hematopoietic cytokine is selected from the group consisting of Epo, TPO, IL-
1 , IL-3, IL-4, IL-5, IL-7, IL-9, EL-l 1, G-CSF, GM-CSF, M-CSF and SCF.
15
wo 03/089569
PCT/US02/31599
1/6
FIG. 1: IL-19 encoding polynucleotide (SEQ ID NO: 1)
atgaagttacagtgtgtttccctttggctcctgggtacaatactgatattgtgctcagt
agacaaccacggtctcaggagatgtctgatttccacagacatgcaccatatagaagaga
gtttccaagaaatcaaaagagGcatccaagctaaggacaccttcccaaatgtcactatc
ctgtccacattggagactctgcagatcattaagcccttagatgtgtgctgcgtgaccaa
gaacctcctggcgttctacgtggacagggtgttcaaggatcatcaggagccaaacccca
aaatcttgagaaaaatcagcagcattgccaactctttcctctacatgcagaaaactctg
cggcaatgtcaggaacagaggcagtgtcactgcaggcaggaagccaccaatgccaccag
agtcatccatgacaactatgatcagctggaggtccacgctgctgccattaaatccctgg
gagagctcgacgtctttctagcctggattaataagaatcatgaagtaatgtcctcagct
wo 03/089569
PCTAJS02/31599
2/6
FIG. 2
FIG. 2:
5 Full-lenth IL-19 (SEQ ID, NO: 2)
MKLQCVSLWL LGTILILCSV DNHGL RRCLI STDMHHIEES FQEIKRAIQA 50
KDTFPNVTIL STLETLQIIK PLDVCCVTKN LLAFYVDRVF KDHQEPNPKI 100
LRKISSIMIS FLYMQKTLRQ CQEQRQCHCR QEATNATRVI HDNYDQLEVH 150
AAAIKSLGEL DVFLAWIWKN HEVMSSA 177
15
20
wo 03/089569
PCT/US02/31599
3/6
FIG. 3
FIG. 3: IL-22 encoding polynucleotide (SEQ ID NO: 3)
atggccgccctgcagaaatctgfcgagctctttccttatggggaccctggccaccagctg
cctccttctcttggccctcttggtacagggaggagcagctgcgcccatcagctcccact
gcaggcttgacaagtccaacttccagcagccctatatcaccaaccgcaccttcatgctg
gctaaggaggctagcttggctgataacaacacagacgttcgtctcattggggagaaact
gttccacggagtcagtatgagtgagcgctgctatctgatgaagcaggtgctgaacttca
cccttgaagaagtgctgttccctcaatctgataggttccagccttatatgcaggaggtg
gtgcccttcctggccaggctcagcaacaggctaagcacatgtcatattgaaggtgatga
cctgcatatccagaggaatgtgcaaaagctgaaggacacagtgaaaaagcttggagaga
gtggagagatcaaagcaattggagaactggatttgctgtttatgtctctgagaaatgcc
tgcattggagatatcgactacaaggatgacgacgacaagcacgtgcatcaccatcacca
tcac
wo 03/089569
PCT/US02/31599
4/6
FIG. 4
FIG. 4: IL-22 (SEQ ID NO: 4)
5 MAALQKSVSS FLMGTLATSC LLLLALLVQG GAAA PISSHC RLDKSNFQQP
YITNRTFMLA KEASLADKNT DVRLIGEKLF HGVSMSERCY LMKQVLNFTI.
EEVLFPQSDR FQPYMQEWP FLARLSNRLS TCHIEODDLH IQRNVQKLKD
TVKKLGESGE IKAIGELDLL FMSLRNACI
10
15
20
wo 03/089569
PCT/US02/31599
5/6
FIG. 5
FIG. 5: IL-24 encoding polynucleotide (SEQ ID NO: 5)
atgaattttcaacagaggctgcaaagcctgtggactttagccagacccttctgccctcc
tttgctggcgacagcctctcaaatgcagatggttgtgctcccttgcctgggttttaccc
tgcttctctggagccaggtatcaggggcccagggccaagaattccactttgggccctgc
caagtgaagggggttgttccccagaaactgtgggaagccttctgggctgtgaaagacac
tatgcaagctcaggataacatcacgagtgcccggctgctgcagcaggaggttctgcaga
acgtctcggatgctgagagctgttaccttgtccacaccctgctggagttctacttgaaa
actgttttcaaaaactaccacaatagaacagttgaagtcaggactctgaagtcattctc
tactctggccaacaactttgttctcatcgtgtcacaactgcaacccagtcaagaaaatg
agatgttttccatcagagacagtgcacacaggcggtttctgctattccggagagcattc
aaacagttggacgtagaagcagctctgaccaaagcccttggggaagtggacattcttct
gacctggatgcagaaattctacaagc
wo 03/089569
PCT/US02/31599
6/6
FIG. 6
FIG. 6: IL-24 (SEQ ID NO: 6)
MNFQQRLQSL WTLARPFCPP LLATA SQMQM WLPCLGFTL LLWSQVSGAQ
GQEFHFGPCQ VKGWPQKLW EAFWAVKDTM QAQDNITSAR LLQQEVLQNV
SDAESCYLVH TLLEFYLKTV FKNYHNRTVE VRTLKSFSTL ANNFVLIVSQ
LQPSQENEMF SIRDSAHRRF LLFRRAFKQL DVEAALTKAL GEVDILLTWM
QKFYKL
>WO 03/089569
PCT/US02/31599
X-15415.ST25.txt
SEQUENCE LISTING
<110> ELI LILLY and company
<120> USE OF IL19, IL22 AND IL24 TO TREAT HEMATOPOIETIC DISORDERS
<130> X-15415
<140> US 60/332,986
<141> 2001-11-06
<150> US 60/332,986
<151> 2001-11-06
<160> 10
<170> Patentin vers-ion 3.1
<210> 1
<211> 531
<212> DNA
<213> Homo sapiens
atgaagttac agtgtgtttc cctttggctc ctgggtacaa tactgatatt gtgctcagta
gacaaccacg gtctcaggag atgtctgatt tccacagaca tgcaccatat agaagagagt
ttccaagaaa tcaaaagagc catccaagct aaggacacct tcccaaatgt cactatcctg
tccacattgg agactctgca gatcattaag cccttagatg tgtgctgcgt gaccaagaac
ctcctggcgt tctacgtgga cagggtgttc aaggatcatc aggagccaaa ccccaaaatc
ttgagaaaaa tcagcagcat tgccaactct ttcctctaca tgcagaaaac tctgcggcaa
tgtcaggaac agaggcagtg tcactgcagg caggaagcca ccaatgccac cagagtcatc
catgacaact atgatcagct ggaggtccac gctgctgcca ttaaatccct gggagagctc
gacgtctttc tagcctggat taataagaat catgaagtaa tgtcctcagc t
Page 1
180
240
300
360
wo 03/089569
PCT/US02/31599
X-15415.ST25.txt
<210> 2
<211> 177
<212> PRT
<213> Homo sapiens
<400> 2
Met Lys Leu Gin Cys Val ser Leu Trp Leu Leu Gly Thr lie Leu He
Leu cys ser Val Asp Asn His Gly Leu Arg Arg cys Leu lie ser Thr
20 ' 25 30
ASP Met His His He Glu Glu Ser Phe Gin Glu He Lys Arg Ala He
35 40 45
Gin Ala Lys Asp Thr phe Pro Asn val Thr He Leu ser Thr Leu Glu
50 55 60
Thr Leu Gin He He Lys Pro Leu Asp Val cys cys Val Thr Lys Asn
65 70 75 80
Leu Leu Ala Phe Tyr Val Asp Arg val Phe Lys Asp His Gin Glu Pro
85 90 95
Asn Pro Lys He Leu Arg Lys He Ser ser He Ala Asn Ser Phe Leu
Tvr Met Gin Lys Thr Leu Arg Gin Cys Gin Glu Gin Arg Gin Cys His
115 120 125
cys Arg Gin Glu Ala Thr Asn Ala Thr Arg Val He His Asp Asn Tyr
. 130 135 140
Asp Gin Leu Glu val His Ala Ala Ala He Lys Ser Leu Gly Glu Leu
145 150 155 160
Asp val Phe Leu Ala Trp He Asn Lys Asn His Glu Val Met ser Ser
165 170 l/j
wo 03/089569
PCT/US02/31599
X-15415.ST25.txt
<211> 594
<212> DNA
<213> Homo sapiens
atggccgccc tgcagaaatc tgtgagctct ttccttatgg ggaccctggc caccagctgc 60
ctccttctct tggccctctt ggtacaggga ggagcagctg cgcccatcag ctcccactgc 120
aggcttgaca agtccaactt ccagcagccc tatatcacca accgcacctt catgctggct 180
aaggaggcta gcttggctga taacaacaca gacgttcgtc tcattgggga gaaactgttc 240
cacggagtca gtatgagtga gcgctgctat ctgatgaagc aggtgctgaa cttcaccctt 300
gaagaagtgc tgttccctca atctgatagg ttccagcctt atatgcagga ggtggtgccc 360
ttcctggcca ggctcagcaa caggctaagc acatgtcata ttgaaggtga tgacctgcat 420
atccagagga atgtgcaaaa gctgaaggac acagtgaaaa agcttggaga gagtggagag 480
atcaaagcaa ttggagaact ggatttgctg tttatgtctc tgagaaatgc ctgcattgga 540
gatatcgact acaaggatga cgacgacaag cacgtgcatc accatcacca tcac 594
<210> 4
<211> 179
<212> PRT
<213> Homo sapiens
Ala Thr ser Cys Leu Leu Leu Leu Ma Leu Leu Val Gin Gly Gly Ala
20 25 30
Ala Ala pro He Ser Ser His cys Arg Leu Asp Lys ser Asn Phe Gin
35 40 45
Gin pro Tyr He Thr Asn Arg Thr Phe Met Leu Ala Lys Glu Ala Ser
50 55 60
Leu Ala Asp Asn Asn Thr Asp val Arg Leu lie Gly Glu Lys Leu Phe
wo 03/089569
PCT/US02/31599
X-15415.ST25.txt
Asn Phe Thr Leu Glu Glu Val Leu Phe Pro Gin Ser Asp Arg Phe Gin
100 105 110
Pro Tyr Met Gin Glu val Val Pro Phe Leu Ala Arg Leu ser Asn Arg
Leu ser Thr cys His He Glu Gly Asp Asp Leu His He Gin Arg Asn
130 135 140
val Gin Lys Leu Lys Asp Thr val Lys Lys Leu Gly Glu Ser Gly Glu
He Lys Ala He Gly Glu Leu Asp Leu Leu Phe Met ser Leu Arg Asn
165 170 175
Ala cys He
<210> 5
<211> 616
<212> DNA
<213> Homo sapiens
atgaattttc aacagaggct gcaaagcctg tggactttag ccagaccctt ctgccctcct
120
180
240
300
ttgctggcga cagcctctca aatgcagatg gttgtgctcc cttgcctggg ttttaccctg
cttctctgga gccaggtatc aggggcccag ggccaagaat tccactttgg gccctgccaa
gtgaaggggg ttgttcccca gaaactgtgg gaagccttct gggctgtgaa agacactatg
' caagctcagg ataacatcac gagtgcccgg ctgctgcagc aggaggttct gcagaacgtc
tcggatgctg agagctgtta ccttgtccac accctgctgg agttctactt gaaaactgtt 360
ttcaaaaact accacaatag aacagttgaa gtcaggactc tgaagtcatt ctctactctg
gccaacaact ttgttctcat cgtgtcacaa ctgcaaccca gtcaagaaaa tgagatgttt
tccatcagag acagtgcaca caggcggttt ctgctattcc ggagagcatt caaacagttg
gacgtagaag cagctctgac caaagccctt ggggaagtgg acattcttct gacctggatg
cagaaattct acaagc
<210> 6
<211> 205
420
480
540
600
616
wo 03/089569 PCT/US02/31599
X-15415.ST25.txt
<212> PRT
<213> Homo sapiens
Met Asn Phe Gin Gin Arg Leu Gin ser Leu Trp Thr Leu Ala Arg Pro
1 5 10 • 15
Phe cys Pro Pro Leu Leu Ala Thr Ala ser Gin Met Gin Met val val
20 25 30
Ala Gin Gly Gin Glu Phe His Phe Gly Pro cys Gin Val Lys Gly Val
val Pro Gln Lys Leu Trp Glu Ala Phe Trp Ala Val Lys Asp Thr Met
55 70 75 80
Gin Ala Gin Asp Asn He Thr Ser Ala Arg Leu Leu Gin Gin Glu Val
"^ 85 90 95
Leu Gin Asn Val Ser Asp Ala Glu Ser Cys Tyr Leu val His xhr Leu
100 105 110
Leu Glu Phe Tyr Leu Lys Thr val Phe Lys Asn Tyr His Asn Arg Thr
115 120 125
Val Glu val Arg Thr Leu Lys Ser Phe Ser Thr Leu Ala Asn Asn Phe
130
Val Leu lie Val ser Gin Leu Gin Pro Ser Gin Glu Asn Glu Met Phe
145 150 155 160
Ser He Arg Asp Ser Ala His Arg Arg Phe Leu Leu Phe Arg Arg Ala
165 170 175
Phe Lys Gin Leu Asp val Glu Ala Ala Leu Thr Lys Ala Leu Gly Glu
180 185 190
val Asp He Leu Leu Thr Trp Met Gin Lys Phe Tyr Lys Leu
195 200 205
<210> 7
<211> 21
wo 03/089569
PCT/US02/31599
X-15415.ST25.txt
<212> DNA
<213> synthetic
gagactgaga gatgaatttt c
<210> 8
<211> 24
<212> DNA
<213> Synthetic
<400> 8
gacattcaga gcttgtagaa tttc
<210> 9
<211> 22
<212> DNA
<213> synthetic
<400> 9
caagtgagag gcatgaagtt ac
<210> 10
<211> 21
<212> DNA
<213> Synthetic
<400> 10
ccttgtcatc aagctgagga c
Page 6
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11